Entry information : RrufPGHS
Entry ID 10739
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: RrufPGHS
Name RrufPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Patellariaceae Rhytidhysteron
Organism Rhytidhysteron rufulum    [TaxId: 37885 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RrufPGHS
start..stop
S start..stop
PnoPGHS01 884 0 2..624 5..623
GzPGHS01 805 0 11..623 25..656
CzmPGHS 803 0 17..624 1..610
FoPGHS 791 0 13..623 7..637
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40053..41862 1810 N° 2 39930..39994 65  
complement(join(39930..39994,40053..41862))


exon

Literature and cross-references RrufPGHS
DNA ref. JGI genome:   NODE_1174_length_51340_cov_42.635704 (41862..39930)
Cluster/Prediction ref. JGI gene:   745
Protein sequence: RrufPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   624
PWM (Da):   %s   70924.43  
PI (pH):   %s   6.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSTNPRDFSLSIWDKLLIWTFKGVNKIIPWHRLPRYIGAINLLAYRDELREHNLYDVYPSPDYQGKPGCPHMEDTEYLSIRNSDGLFNDLNQPQMGCAGMRFGRNVPRKYTKKPTEEEMMTPNPRVISEQLLARDEFKPATIVNLLAAAWIQFQVHDWFMHTNSTDEKYDVPLPEGDTWSDSSMKIEATQADKPLDKTDNVAPGYGNENTHWWDGSQIYGSSEERTKELRGSSEKGKLTVDLQTMDTFLPRDAQGIPETGFYTNWWIGLEMMHTLFVLEHNAICDELAVHNPTWTSDQLFDTARLINCALMAKIHTVEWTPAILAHPALEIGMNANWWGLLGERLYKMLGRVSKGEVLSGIPGSTADHDGVPYSLTEEFVSVYRLHPLIPDNIAFFDAETGTHARTYPISSVAFANARKPLKESNFTFSDLFYSFGINYPGAITINNTPNFLRDLHTPDNRHIDLGTIDILRDRERGVPRYNTFRRLFHLRPASSFLSLTGGKKDLANRLASIYNNDIESVDLLVGCLCEPLPKGFGFSDTAFRVFILMASRRLKSDRFIATEWKEEVYTREGMQWIQEGGFAGVLTRHFPVLRSSLRGVKNPFAPWEKVGSSAEYKGVETNA

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCCACAAACCCCAGAGACTTCTCCCTCTCCATCTGGGATAAGCTCTTGATCTGGACATTCAAGGGTGTTAATAAGATTATCCCTTGGCATCGTCTCCCCAGATACATCGGAGCT
ATCAACCTCCTCGCTTATCGTGATGAGTTACGAGAACATAACCTTTACGATGTGTATCCATCACCAGACTATCAAGGCAAGCCTGGATGCCCTCACATGGAGGATACCGAGTACCTTTCT
ATTCGGAATTCCGATGGGCTATTCAACGATCTTAATCAGCCACAGATGGGTTGTGCTGGTATGAGGTTTGGGAGAAACGTACCTCGCAAGTATACGAAGAAGCCGACTGAGGAGGAAATG
ATGACCCCGAATCCAAGGGTCATCAGTGAACAGCTATTGGCGAGAGATGAGTTCAAGCCGGCTACTATCGTCAATCTTCTAGCTGCCGCTTGGATTCAGTTTCAAGTCCATGATTGGTTC
ATGCATACGAATAGCACGGACGAGAAATATGACGTCCCTCTTCCCGAGGGCGATACCTGGTCCGATTCTTCCATGAAAATCGAAGCCACCCAAGCCGATAAACCCCTCGATAAAACCGAC
AATGTAGCTCCGGGATACGGAAACGAAAACACGCACTGGTGGGATGGCTCTCAGATTTACGGCTCCAGTGAAGAAAGAACCAAGGAGCTTCGTGGTAGCTCCGAGAAGGGCAAGCTCACT
GTTGATTTGCAAACCATGGACACTTTTCTTCCTCGTGATGCTCAAGGTATCCCGGAAACGGGCTTTTACACGAATTGGTGGATCGGTCTCGAGATGATGCATACGTTGTTCGTCCTAGAA
CATAACGCTATTTGCGATGAACTCGCTGTTCATAACCCCACGTGGACGAGTGACCAACTCTTCGATACCGCTCGTCTCATCAACTGTGCCTTGATGGCAAAGATCCACACTGTCGAATGG
ACACCAGCTATCCTAGCTCACCCGGCTCTCGAAATCGGTATGAACGCCAACTGGTGGGGCCTCCTCGGCGAGCGCCTCTACAAAATGCTCGGCCGTGTATCCAAAGGCGAGGTCTTAAGC
GGTATCCCAGGCTCGACCGCAGACCACGACGGAGTACCCTACTCCCTAACCGAAGAATTTGTCTCCGTATACCGCTTACACCCACTCATACCCGATAACATCGCCTTCTTCGACGCCGAA
ACAGGGACTCATGCCCGCACCTATCCCATCTCCTCAGTCGCATTCGCCAACGCTCGTAAACCGCTGAAAGAATCCAACTTCACCTTCTCAGATCTCTTTTACTCCTTCGGAATCAATTAC
CCCGGCGCCATCACCATAAACAACACCCCCAACTTTCTCCGCGACCTCCACACCCCAGACAACCGCCACATCGACCTCGGCACCATCGACATCCTGCGTGATCGCGAACGCGGCGTCCCC
CGGTACAACACCTTCCGACGCCTCTTCCACCTCCGCCCCGCATCATCCTTCCTCTCCCTCACAGGCGGCAAAAAAGACCTCGCAAACCGACTCGCATCCATCTACAACAACGACATCGAA
AGTGTCGATTTACTCGTTGGATGTCTCTGCGAACCGTTGCCTAAGGGGTTCGGGTTCAGTGACACGGCGTTTAGGGTTTTTATCCTTATGGCTAGTAGGCGGTTGAAGAGTGATCGGTTT
ATTGCGACGGAGTGGAAGGAGGAGGTTTATACGAGGGAGGGGATGCAGTGGATTCAGGAGGGGGGTTTTGCGGGGGTGTTGACGAGGCATTTTCCTGTTTTGAGGAGTTCGCTGAGGGGG
GTTAAGAATC
GTGAGTTATCCTTTAATATACCCTTGGTTTTGAGACTGTGATGCTAACCTTTTTATAGCTTTCGCGCCTTGGGAGAAGGTGGGTAGTTCGGCGGAGTATAAGGGGGTGGA
AACGAATGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCCACAAACCCCAGAGACTTCTCCCTCTCCATCTGGGATAAGCTCTTGATCTGGACATTCAAGGGTGTTAATAAGATTATCCCTTGGCATCGTCTCCCCAGATACATCGGAGCT
ATCAACCTCCTCGCTTATCGTGATGAGTTACGAGAACATAACCTTTACGATGTGTATCCATCACCAGACTATCAAGGCAAGCCTGGATGCCCTCACATGGAGGATACCGAGTACCTTTCT
ATTCGGAATTCCGATGGGCTATTCAACGATCTTAATCAGCCACAGATGGGTTGTGCTGGTATGAGGTTTGGGAGAAACGTACCTCGCAAGTATACGAAGAAGCCGACTGAGGAGGAAATG
ATGACCCCGAATCCAAGGGTCATCAGTGAACAGCTATTGGCGAGAGATGAGTTCAAGCCGGCTACTATCGTCAATCTTCTAGCTGCCGCTTGGATTCAGTTTCAAGTCCATGATTGGTTC
ATGCATACGAATAGCACGGACGAGAAATATGACGTCCCTCTTCCCGAGGGCGATACCTGGTCCGATTCTTCCATGAAAATCGAAGCCACCCAAGCCGATAAACCCCTCGATAAAACCGAC
AATGTAGCTCCGGGATACGGAAACGAAAACACGCACTGGTGGGATGGCTCTCAGATTTACGGCTCCAGTGAAGAAAGAACCAAGGAGCTTCGTGGTAGCTCCGAGAAGGGCAAGCTCACT
GTTGATTTGCAAACCATGGACACTTTTCTTCCTCGTGATGCTCAAGGTATCCCGGAAACGGGCTTTTACACGAATTGGTGGATCGGTCTCGAGATGATGCATACGTTGTTCGTCCTAGAA
CATAACGCTATTTGCGATGAACTCGCTGTTCATAACCCCACGTGGACGAGTGACCAACTCTTCGATACCGCTCGTCTCATCAACTGTGCCTTGATGGCAAAGATCCACACTGTCGAATGG
ACACCAGCTATCCTAGCTCACCCGGCTCTCGAAATCGGTATGAACGCCAACTGGTGGGGCCTCCTCGGCGAGCGCCTCTACAAAATGCTCGGCCGTGTATCCAAAGGCGAGGTCTTAAGC
GGTATCCCAGGCTCGACCGCAGACCACGACGGAGTACCCTACTCCCTAACCGAAGAATTTGTCTCCGTATACCGCTTACACCCACTCATACCCGATAACATCGCCTTCTTCGACGCCGAA
ACAGGGACTCATGCCCGCACCTATCCCATCTCCTCAGTCGCATTCGCCAACGCTCGTAAACCGCTGAAAGAATCCAACTTCACCTTCTCAGATCTCTTTTACTCCTTCGGAATCAATTAC
CCCGGCGCCATCACCATAAACAACACCCCCAACTTTCTCCGCGACCTCCACACCCCAGACAACCGCCACATCGACCTCGGCACCATCGACATCCTGCGTGATCGCGAACGCGGCGTCCCC
CGGTACAACACCTTCCGACGCCTCTTCCACCTCCGCCCCGCATCATCCTTCCTCTCCCTCACAGGCGGCAAAAAAGACCTCGCAAACCGACTCGCATCCATCTACAACAACGACATCGAA
AGTGTCGATTTACTCGTTGGATGTCTCTGCGAACCGTTGCCTAAGGGGTTCGGGTTCAGTGACACGGCGTTTAGGGTTTTTATCCTTATGGCTAGTAGGCGGTTGAAGAGTGATCGGTTT
ATTGCGACGGAGTGGAAGGAGGAGGTTTATACGAGGGAGGGGATGCAGTGGATTCAGGAGGGGGGTTTTGCGGGGGTGTTGACGAGGCATTTTCCTGTTTTGAGGAGTTCGCTGAGGGGG
GTTAAGAATC
CTTTCGCGCCTTGGGAGAAGGTGGGTAGTTCGGCGGAGTATAAGGGGGTGGAAACGAATGCATGA

Retrieve as FASTA