Entry information : NdisPGHS01
Entry ID 10741
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-26 (Catherine Mathe (Scipio))
Peroxidase information: NdisPGHS01
Name NdisPGHS01
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora discreta    [TaxId: 29879 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NdisPGHS01
start..stop
S start..stop
NtetPGHS01_2509 1259 0 1..648 1..650
NcPGHS01 1245 0 1..648 1..651
SmaPGHS 1221 0 1..648 1..652
HpulPGHS 937 0 29..648 5..623
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 167777..168346 570 N° 2 166964..167648 685 N° 3 166203..166891 689  
complement(join(166203..166891,166964..167648,167777..168346))


exon

Literature and cross-references NdisPGHS01
DNA ref. JGI genome:   scaffold_5 (168346..166203)
Cluster/Prediction ref. JGI gene:   96132
Protein sequence: NdisPGHS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   649
PWM (Da):   %s   73285.68  
PI (pH):   %s   6.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPHSLSKPNGTTSSISSLEDNKDRKQVELQPSFTPTLLERLGITSFHLLNKLIPWYKLPGFIGAFNLAFLRIELRQYNLHDAYASPQAQGSSITDPLPDQRYLGARHSDGKFNDLKQPKMGCTGMRFGRNFPREACVKPSKEELMTPNPRMISERFMARKEEKFIPATTLNLLAAAWIQFQTHDWFFHEQTPHEKLNVSLSKDDKWLEEHMQLYATKPDEALDASDIKCPGYKNLNTHWWDGSQIYGSSESATQKLRNRDPDGKLPLDSCGREQFLPRDQDGNVLTGFNDNWWVGMEILHTLFALEHNAICDALRKEYPNWSGDQIFDKARLVNCALMAKIHTVEWTPAILAHPALQTGMAANWWGIVGEKLTKIAGRLSKTSEIISGIPGSGAEQDGTPYSLTEEFVSVYRMHSLMPETIAFFSATDGHHATTIPTVDTTFTKSQTPFDDGLSFADVFYSFGINYPGAITNNNYPDFLRNLRTPDGQVRDLGTVDILRDRERGVPRYCEFRRMLRLSVPKTFDELAGAALAKELAEAYNNDISLVDALVGSHSEPVIPGFGFSETAFRIFILMASRRLKSDRFIAGEWNEEMYTKVGFKWVQDSGMKDVLGRHFPELRETLKGSKNVFAPWQMKASSKEYKGVETN

Retrieve as FASTA  
Remarks Complete sequenc efrom genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCACAGCCTCTCCAAACCAAACGGCACCACCTCTTCCATCTCGTCCCTTGAAGACAACAAGGACAGGAAGCAGGTAGAACTTCAACCCTCCTTCACACCCACCCTCCTCGAACGA
CTGGGCATCACCTCCTTCCACCTCCTCAACAAGTTAATCCCATGGTACAAACTCCCCGGCTTCATCGGTGCCTTTAACCTGGCCTTTCTGCGCATTGAGCTCCGTCAATACAACCTGCAC
GACGCCTATGCATCTCCCCAAGCCCAAGGCAGTTCCATCACCGACCCTCTTCCCGACCAACGCTACCTGGGCGCTCGCCACTCCGATGGCAAGTTCAATGACTTGAAGCAACCCAAAATG
GGATGCACGGGCATGAGGTTCGGGAGGAATTTCCCGCGGGAGGCTTGTGTGAAACCGAGCAAGGAGGAGCTGATGACGCCAAATCCGAGGATGATCAGTGAGAGGTTTATGGCGAGGAAG
GAAGAGAAGTTCATCCCGGCGACGACACTGAATCTGTTGGCGGCGGCGTGGATCCAGTTCCAGACGCATGATTGGTTTTTTCATGAGCAG
GTATGTGTAACCACAACTTTTCGACTCGAT
TTTTGAGACTTTGCCGACTCTACAATTGTGGTAATCCTGTGGCTTCAGCTTCTTCCTTCCCGTCATTGGCTAACCCCGTTCGGCTTTCAATGTCTCAGACCCCCCACGAAAAGCTTAACG
TCTCGCTCTCCAAGGACGACAAGTGGCTTGAAGAGCATATGCAGCTGTACGCCACCAAGCCAGATGAGGCTCTTGACGCATCCGACATCAAGTGTCCCGGGTACAAGAACCTCAATACCC
ACTGGTGGGACGGATCACAGATCTACGGCTCCTCCGAGTCCGCAACACAAAAGCTCCGCAACCGCGATCCAGACGGCAAGTTACCCCTCGACAGTTGCGGGCGTGAGCAATTCCTCCCTC
GGGACCAAGATGGAAACGTCTTGACCGGCTTCAACGATAACTGGTGGGTGGGAATGGAGATCCTGCACACGCTATTTGCGCTGGAGCACAATGCCATTTGCGATGCGTTGCGCAAGGAGT
ATCCCAATTGGAGCGGGGACCAGATCTTTGACAAGGCGAGACTGGTGAACTGTGCTTTGATGGCCAAGATTCATACGGTTGAGTGGACACCGGCAATTCTGGCGCATCCGGCGCTGCAGA
CTGGAATGGCTGCCAACTGGTGGGGGATTGTCGGAGAGAAGTTGACCAAGATCGCGGGAAGACTGTCCAAGACGAGCGAGATCATCAGTGGAATTCCCGGCAGCGGAGCGGAGCAGGATG
GGACGCCGTACTCACTAACAGAGGAGTTTGTCTCGGTTTATCGGATGCATTCGTTGATGCCTG
GTTTGTGCTCCCTTCCTCCCATCCCCTTCAGTCGGTTACCTCCCCCCACTAACCGCA
GTGCCCCGTCTGCAGAAACAATCGCCTTCTTCTCCGCCACCGACGGCCACCACGCCACCACCATCCCCACGGTCGACACAACCTTCACCAAATCCCAAACGCCCTTCGACGACGGCCTCT
CCTTCGCCGACGTCTTCTACTCCTTCGGCATCAACTACCCCGGCGCCATCACCAACAACAACTACCCCGATTTCCTACGCAACCTGCGCACCCCCGACGGCCAAGTCCGCGACCTCGGAA
CCGTCGACATTCTCCGCGACCGCGAGCGCGGCGTCCCTCGCTACTGCGAGTTCCGGCGTATGCTTCGTCTCTCTGTGCCCAAGACCTTTGACGAACTTGCCGGCGCGGCCCTGGCCAAAG
AACTGGCAGAGGCCTACAACAACGACATTTCCCTCGTCGACGCGTTGGTCGGCTCGCACTCGGAGCCCGTGATTCCAGGGTTCGGATTCAGCGAGACGGCGTTCCGGATTTTTATCTTGA
TGGCGAGCAGGAGGCTGAAGAGCGATCGGTTCATTGCCGGCGAGTGGAACGAGGAGATGTACACCAAGGTTGGGTTCAAGTGGGTGCAGGATAGCGGGATGAAGGACGTGTTGGGGAGAC
ATTTTCCGGAGCTGAGGGAGACGTTGAAGGGGAGCAAGAATGTGTTTGCGCCGTGGCAGATGAAGGCGAGCAGTAAGGAGTACAAGGGGGTGGAAACTAATGCG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCACAGCCTCTCCAAACCAAACGGCACCACCTCTTCCATCTCGTCCCTTGAAGACAACAAGGACAGGAAGCAGGTAGAACTTCAACCCTCCTTCACACCCACCCTCCTCGAACGA
CTGGGCATCACCTCCTTCCACCTCCTCAACAAGTTAATCCCATGGTACAAACTCCCCGGCTTCATCGGTGCCTTTAACCTGGCCTTTCTGCGCATTGAGCTCCGTCAATACAACCTGCAC
GACGCCTATGCATCTCCCCAAGCCCAAGGCAGTTCCATCACCGACCCTCTTCCCGACCAACGCTACCTGGGCGCTCGCCACTCCGATGGCAAGTTCAATGACTTGAAGCAACCCAAAATG
GGATGCACGGGCATGAGGTTCGGGAGGAATTTCCCGCGGGAGGCTTGTGTGAAACCGAGCAAGGAGGAGCTGATGACGCCAAATCCGAGGATGATCAGTGAGAGGTTTATGGCGAGGAAG
GAAGAGAAGTTCATCCCGGCGACGACACTGAATCTGTTGGCGGCGGCGTGGATCCAGTTCCAGACGCATGATTGGTTTTTTCATGAGCAG
ACCCCCCACGAAAAGCTTAACGTCTCGCTC
TCCAAGGACGACAAGTGGCTTGAAGAGCATATGCAGCTGTACGCCACCAAGCCAGATGAGGCTCTTGACGCATCCGACATCAAGTGTCCCGGGTACAAGAACCTCAATACCCACTGGTGG
GACGGATCACAGATCTACGGCTCCTCCGAGTCCGCAACACAAAAGCTCCGCAACCGCGATCCAGACGGCAAGTTACCCCTCGACAGTTGCGGGCGTGAGCAATTCCTCCCTCGGGACCAA
GATGGAAACGTCTTGACCGGCTTCAACGATAACTGGTGGGTGGGAATGGAGATCCTGCACACGCTATTTGCGCTGGAGCACAATGCCATTTGCGATGCGTTGCGCAAGGAGTATCCCAAT
TGGAGCGGGGACCAGATCTTTGACAAGGCGAGACTGGTGAACTGTGCTTTGATGGCCAAGATTCATACGGTTGAGTGGACACCGGCAATTCTGGCGCATCCGGCGCTGCAGACTGGAATG
GCTGCCAACTGGTGGGGGATTGTCGGAGAGAAGTTGACCAAGATCGCGGGAAGACTGTCCAAGACGAGCGAGATCATCAGTGGAATTCCCGGCAGCGGAGCGGAGCAGGATGGGACGCCG
TACTCACTAACAGAGGAGTTTGTCTCGGTTTATCGGATGCATTCGTTGATGCCTG
AAACAATCGCCTTCTTCTCCGCCACCGACGGCCACCACGCCACCACCATCCCCACGGTCGACACA
ACCTTCACCAAATCCCAAACGCCCTTCGACGACGGCCTCTCCTTCGCCGACGTCTTCTACTCCTTCGGCATCAACTACCCCGGCGCCATCACCAACAACAACTACCCCGATTTCCTACGC
AACCTGCGCACCCCCGACGGCCAAGTCCGCGACCTCGGAACCGTCGACATTCTCCGCGACCGCGAGCGCGGCGTCCCTCGCTACTGCGAGTTCCGGCGTATGCTTCGTCTCTCTGTGCCC
AAGACCTTTGACGAACTTGCCGGCGCGGCCCTGGCCAAAGAACTGGCAGAGGCCTACAACAACGACATTTCCCTCGTCGACGCGTTGGTCGGCTCGCACTCGGAGCCCGTGATTCCAGGG
TTCGGATTCAGCGAGACGGCGTTCCGGATTTTTATCTTGATGGCGAGCAGGAGGCTGAAGAGCGATCGGTTCATTGCCGGCGAGTGGAACGAGGAGATGTACACCAAGGTTGGGTTCAAG
TGGGTGCAGGATAGCGGGATGAAGGACGTGTTGGGGAGACATTTTCCGGAGCTGAGGGAGACGTTGAAGGGGAGCAAGAATGTGTTTGCGCCGTGGCAGATGAAGGCGAGCAGTAAGGAG
TACAAGGGGGTGGAAACTAATGCG

Retrieve as FASTA