Entry information : NhaePGHS
Entry ID 10742
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Catherine Mathe (Scipio))
Peroxidase information: NhaePGHS
Name NhaePGHS
Class H synthase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Nectria
Organism Nectria haematococca    [TaxId: 140110 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NhaePGHS
start..stop
S start..stop
FoPGHS 1065 0 31..676 4..641
GmoPGHS01 1060 0 1..676 1..665
GzPGHS01 1053 0 16..673 9..657
RrufPGHS 771 0 34..672 13..623
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 122366..123487 1122 N° 2 121460..122293 834 N° 3 121297..121404 108  
complement(join(121297..121404,121460..122293,122366..123487))


exon

Literature and cross-references NhaePGHS
DNA ref. JGI genome:   sca_33_chr6_1_0 (123487..121297)
Cluster/Prediction ref. JGI gene:   42274
Protein sequence: NhaePGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   687
PWM (Da):   %s   77552.13 Transmb domain:   %s   i13-35o
PI (pH):   %s   6.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSKIIEGGLAASKSFFAILSAFFLGMLSFLGPVFKSLFIGFWKIVNNFVHWHKLPAWIGIFNLLALRYELRKKNLYDTYTDAGSQGTVASCPMKDSKFISSRNSNGYFNDLGAPKMGCVGMRFGRNVPRDQTKPPSEEELLTPNPRVISKRILARPDGEFKPAVIVNLLAAAWIQFQVHDWAQHKFDTSKETHIDIPLNPDDGWSDKKMDVPRTKKAEDDLSEQDVETPAYDNENTHWWDASQIYGSTEDKTKELRAKCHKTHPGQLAVTVGDGEQFLPRGDDGIPLTGFRQNWWLGLELLHTLFALEHNAIAKQLHLSNPTWSSDRIFDTARLVNCALMAKIHTVEWTPGILQHPTLQIAMDANWWGLLGEKLWHVFGRPFGNKSEVLSGIPGSDVNHDNVPYSLTEEFVSVYRLHPLIPDNIAFFNVKDGQHEGTLSIKEVAFESARKPLEEKAQDEEGDNGRLGLDFADVFYSFGVNYPGAIRAHNMPNFLRDLKIPKDDDFPEGRHLDLGAIDILRDRERGVPRYNAFRRLFHMPPARTFIELTGDDEKLAAELDEVYNGDIEAVDLLVGTLSEPLPEGFGFSDTAFRVFILMASRRIKSDRFLAGDGWCPEIYTHEGISWVQNNTMKDVLCRHFPELAGPLHSVKNAFAPWEKIGQTDKYMGVETNKPEDLAAARASARVY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAAAATTATCGAAGGGGGCCTTGCCGCCTCGAAGTCTTTTTTTGCCATATTGAGTGCCTTCTTCCTCGGAATGCTGTCTTTTCTTGGGCCCGTCTTTAAATCTCTTTTTATT
GGTTTCTGGAAGATCGTCAACAATTTCGTCCACTGGCATAAACTCCCTGCCTGGATCGGCATCTTCAACCTCCTCGCTTTGCGCTATGAGCTTCGCAAGAAGAACTTGTACGACACTTAT
ACTGACGCTGGGTCTCAGGGTACGGTCGCATCATGCCCAATGAAGGACTCCAAGTTCATCTCTTCGCGAAATTCGAATGGCTATTTCAATGATCTTGGTGCACCCAAGATGGGATGCGTT
GGAATGAGGTTCGGTCGCAATGTGCCGAGAGATCAAACCAAACCACCCAGCGAGGAGGAGCTTCTCACACCGAATCCGAGAGTCATCTCTAAGAGAATCCTTGCGCGGCCCGATGGCGAG
TTCAAGCCTGCGGTCATTGTGAACTTGCTCGCTGCTGCTTGGATCCAGTTTCAGGTGCATGATTGGGCGCAGCACAAGTTTGACACGAGCAAAGAGACTCACATTGACATTCCCTTGAAC
CCAGATGATGGATGGTCTGACAAGAAGATGGACGTTCCACGCACTAAAAAAGCCGAGGATGATCTCTCTGAGCAGGATGTTGAAACACCAGCATACGACAACGAGAACACACACTGGTGG
GATGCCTCCCAGATCTATGGATCTACCGAGGACAAAACGAAAGAACTGCGGGCCAAGTGTCATAAGACTCATCCCGGCCAGCTCGCAGTTACGGTTGGCGACGGAGAGCAGTTCTTGCCC
CGTGGGGATGACGGGATCCCCCTCACAGGGTTTCGTCAGAATTGGTGGCTTGGGCTTGAACTCTTGCACACCCTCTTCGCCCTCGAACATAACGCCATCGCTAAGCAACTTCACCTTTCA
AATCCTACATGGTCGAGCGATCGGATCTTCGACACTGCCAGACTAGTCAACTGTGCGCTTATGGCCAAGATCCATACTGTCGAGTGGACGCCTGGTATCCTGCAACATCCCACCTTACAG
ATCGCCATGGATGCAAACTGGTGGGGGCTTCTTGGCGAAAAG
GTGAGTCTGATAACTCTTTGTTGTTTAAATACGTCGTATTCAGTATATGAGAAACTAACTGGGTTATACTAGCTCTGG
CACGTCTTTGGAAGGCCTTTTGGAAACAAGTCCGAGGTTCTTTCTGGCATTCCAGGCTCGGATGTGAACCACGATAATGTCCCATATTCTCTTACCGAGGAGTTTGTGTCTGTCTACCGT
CTCCACCCTCTCATTCCTGACAACATCGCCTTCTTCAACGTCAAGGACGGCCAGCACGAGGGTACTCTCTCAATCAAGGAAGTTGCTTTCGAGTCCGCCCGCAAACCTCTAGAGGAAAAG
GCTCAAGACGAGGAGGGAGATAACGGACGCTTAGGACTGGACTTTGCGGACGTTTTTTACTCCTTCGGCGTTAACTACCCAGGTGCGATACGTGCCCACAACATGCCCAACTTCCTCCGG
GATTTGAAGATCCCGAAGGACGATGACTTTCCCGAGGGCCGTCACTTAGATCTGGGGGCTATCGACATCCTTCGAGACCGTGAACGCGGTGTCCCTCGGTACAATGCCTTCCGTCGTTTG
TTTCACATGCCCCCCGCCCGCACCTTTATCGAGCTCACTGGTGACGATGAGAAGCTGGCTGCTGAACTGGACGAGGTCTACAACGGTGACATTGAGGCCGTGGACCTCCTTGTTGGCACT
CTCAGCGAGCCTCTGCCCGAAGGTTTTGGTTTCAGTGACACCGCCTTCCGTGTGTTCATTCTGATGGCCAGTCGCCGTATCAAGTCTGACCGGTTCCTTGCTGGCGATGGTTGGTGCCCA
GAGATTTACACCCATGAAGGTATCAGCTGGGTGCAGAACAACACCATGAAAGATGTGCTTTGCAGGCATTTCCCTGAGCTTGCTGGGCCACTGCATAGTGTTAAGAAT
GTGAGATTCGTT
TTAAGTCTAATAAGAAGTGTACTATTGCTAACTTATATGATAGGCTTTTGCTCCCTGGGAGAAAATTGGTCAGACCGACAAATATATGGGCGTGGAGACAAACAAACCAGAGGATCTGGC
TGCCGCGAGGGCCTCAGCTAGGGTTTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAAAATTATCGAAGGGGGCCTTGCCGCCTCGAAGTCTTTTTTTGCCATATTGAGTGCCTTCTTCCTCGGAATGCTGTCTTTTCTTGGGCCCGTCTTTAAATCTCTTTTTATT
GGTTTCTGGAAGATCGTCAACAATTTCGTCCACTGGCATAAACTCCCTGCCTGGATCGGCATCTTCAACCTCCTCGCTTTGCGCTATGAGCTTCGCAAGAAGAACTTGTACGACACTTAT
ACTGACGCTGGGTCTCAGGGTACGGTCGCATCATGCCCAATGAAGGACTCCAAGTTCATCTCTTCGCGAAATTCGAATGGCTATTTCAATGATCTTGGTGCACCCAAGATGGGATGCGTT
GGAATGAGGTTCGGTCGCAATGTGCCGAGAGATCAAACCAAACCACCCAGCGAGGAGGAGCTTCTCACACCGAATCCGAGAGTCATCTCTAAGAGAATCCTTGCGCGGCCCGATGGCGAG
TTCAAGCCTGCGGTCATTGTGAACTTGCTCGCTGCTGCTTGGATCCAGTTTCAGGTGCATGATTGGGCGCAGCACAAGTTTGACACGAGCAAAGAGACTCACATTGACATTCCCTTGAAC
CCAGATGATGGATGGTCTGACAAGAAGATGGACGTTCCACGCACTAAAAAAGCCGAGGATGATCTCTCTGAGCAGGATGTTGAAACACCAGCATACGACAACGAGAACACACACTGGTGG
GATGCCTCCCAGATCTATGGATCTACCGAGGACAAAACGAAAGAACTGCGGGCCAAGTGTCATAAGACTCATCCCGGCCAGCTCGCAGTTACGGTTGGCGACGGAGAGCAGTTCTTGCCC
CGTGGGGATGACGGGATCCCCCTCACAGGGTTTCGTCAGAATTGGTGGCTTGGGCTTGAACTCTTGCACACCCTCTTCGCCCTCGAACATAACGCCATCGCTAAGCAACTTCACCTTTCA
AATCCTACATGGTCGAGCGATCGGATCTTCGACACTGCCAGACTAGTCAACTGTGCGCTTATGGCCAAGATCCATACTGTCGAGTGGACGCCTGGTATCCTGCAACATCCCACCTTACAG
ATCGCCATGGATGCAAACTGGTGGGGGCTTCTTGGCGAAAAG
CTCTGGCACGTCTTTGGAAGGCCTTTTGGAAACAAGTCCGAGGTTCTTTCTGGCATTCCAGGCTCGGATGTGAACCAC
GATAATGTCCCATATTCTCTTACCGAGGAGTTTGTGTCTGTCTACCGTCTCCACCCTCTCATTCCTGACAACATCGCCTTCTTCAACGTCAAGGACGGCCAGCACGAGGGTACTCTCTCA
ATCAAGGAAGTTGCTTTCGAGTCCGCCCGCAAACCTCTAGAGGAAAAGGCTCAAGACGAGGAGGGAGATAACGGACGCTTAGGACTGGACTTTGCGGACGTTTTTTACTCCTTCGGCGTT
AACTACCCAGGTGCGATACGTGCCCACAACATGCCCAACTTCCTCCGGGATTTGAAGATCCCGAAGGACGATGACTTTCCCGAGGGCCGTCACTTAGATCTGGGGGCTATCGACATCCTT
CGAGACCGTGAACGCGGTGTCCCTCGGTACAATGCCTTCCGTCGTTTGTTTCACATGCCCCCCGCCCGCACCTTTATCGAGCTCACTGGTGACGATGAGAAGCTGGCTGCTGAACTGGAC
GAGGTCTACAACGGTGACATTGAGGCCGTGGACCTCCTTGTTGGCACTCTCAGCGAGCCTCTGCCCGAAGGTTTTGGTTTCAGTGACACCGCCTTCCGTGTGTTCATTCTGATGGCCAGT
CGCCGTATCAAGTCTGACCGGTTCCTTGCTGGCGATGGTTGGTGCCCAGAGATTTACACCCATGAAGGTATCAGCTGGGTGCAGAACAACACCATGAAAGATGTGCTTTGCAGGCATTTC
CCTGAGCTTGCTGGGCCACTGCATAGTGTTAAGAAT
GCTTTTGCTCCCTGGGAGAAAATTGGTCAGACCGACAAATATATGGGCGTGGAGACAAACAAACCAGAGGATCTGGCTGCCGCG
AGGGCCTCAGCTAGGGTTTATTAA

Retrieve as FASTA