Entry information : MfiPGHS
Entry ID 10743
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MfiPGHS
Name MfiPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella fijiensis (Pseudocercospora fijiensis)    [TaxId: 83344 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MfiPGHS
start..stop
S start..stop
CzmPGHS 987 0 10..602 2..610
GzPGHS01 769 0 11..601 33..656
FoPGHS 755 0 7..601 9..637
RrufPGHS 753 0 10..601 18..623
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2792812..2793425 614 N° 2 2793486..2793865 380 N° 3 2793976..2794832 857  
join(2792812..2793425,2793486..2793865,2793976..2794832)


exon

Literature and cross-references MfiPGHS
DNA ref. JGI genome:   scaffold_4 (2792812..2794832)
Cluster/Prediction ref. JGI gene:   188262
Protein sequence: MfiPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   617
PWM (Da):   %s   70400.48  
PI (pH):   %s   6.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGYTCAQASLVAFFKFINTFISWHKLPPLIGALNLLALRDELREKNLVDTYPSEQFQGPAQSDVLTDTKFICARNSDGLYNDLDKPKMGCRGMRFGRNVPRKFTEKPSDFDLMHPDPRLISQKLLQRTEFQGAYIVNLLAAAWIQFQVHDWAQHTNSKTKFHEIKLKSDDPWPDHPMKVAKTVQDEVLDDQDRKYPAYANENTHWWDASQIYGSTEAETRLLRSKHDDGTMDVDRFQGEQFLPRGVDNIPLTGFNHNWWLGLELLHTLFALEHNAICSMLKTKNPSWTGDELFDVARLINCALMAKIHTIEWTPAILPHPTLGIGMNANWAFTGIPESGTDQGKAPYCLTEEFVSVYRLHSLLPDDVAFFNLKTGTHTQTVPIEQVSFEHARSQFDPQDKSKQLGFTDAFYSFGINYPGAIRINNMPKFLRDLKKPDGEHLDMGAVDVLRDRERGVPRYCQFRRLFHMSAPKNFEALTGGDKKLAVELSQIYEGDVEKVDLLIGCLCEPLPQGFGFSETQFRVFILMASRRLKSDRFIASDFKQEMYTREGIEWVQSNTMRDVLIRHFPDLRGPLRDVKNAFAPWGKVGKSGEHFGKEVSTRDELEKAGLLSLLK

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTACACTTGTGCTCAGGCCTCCTTGGTCGCCTTTTTCAAGTTCATCAACACCTTCATATCATGGCACAAGCTGCCGCCTCTCATTGGAGCCCTGAATCTCCTGGCTCTTCGAGAT
GAGCTGCGCGAGAAGAACTTGGTCGACACATATCCCTCGGAGCAGTTCCAGGGTCCTGCACAGAGCGATGTGTTGACCGACACCAAATTTATCTGTGCCCGCAACTCCGATGGGCTTTAC
AATGATCTGGACAAGCCCAAGATGGGCTGCAGAGGAATGCGATTCGGTCGCAACGTCCCGCGAAAGTTCACTGAAAAGCCAAGCGATTTCGACCTGATGCACCCAGATCCACGACTCATC
AGTCAGAAGCTGCTCCAGAGGACAGAGTTCCAAGGCGCCTACATTGTCAATCTCCTCGCCGCTGCCTGGATTCAGTTTCAGGTGCACGACTGGGCACAGCATACGAATAGCAAAACCAAA
TTCCACGAGATCAAGCTCAAGTCGGATGACCCATGGCCGGACCACCCAATGAAAGTCGCCAAGACGGTACAGGATGAGGTACTGGATGATCAGGATCGCAAGTATCCCGCTTACGCCAAT
GAGAACACTCACTG
GTAAGTTAAACATCAACAGAATATGTAATGGCACAGAACCGCAGCTGATCCTTGATTCAGGTGGGACGCTTCGCAAATCTACGGGTCCACTGAAGCAGAGACACGG
CTTCTTCGCAGCAAACATGACGATGGCACCATGGACGTTGATCGATTCCAAGGCGAACAATTCTTGCCACGAGGCGTTGATAACATTCCCTTGACAGGCTTTAACCATAATTGGTGGCTC
GGTCTGGAGCTACTACACACTCTCTTCGCCTTGGAACACAATGCGATCTGTAGCATGCTCAAGACCAAGAATCCGAGCTGGACTGGAGATGAACTTTTTGATGTAGCTCGACTGATCAAT
TGTGCCCTGATGGCGAAAATCCACACCATTGAATGGACTCCAGCAATTTTGCCACATCCGACCTTGGGCATTGGCATGAATGCCAACTGGAGTG
GTCTTCTTGGGCCAAAATGGGAAGAG
CACATTGCGACTGCGACATATCCGATGATTTCAGCTAATGAAATTGCAGGCAACAACTCCTCTCCTTCTTCGGTCAGAGCGAAGCTTTCACCGGCATTCCAGAATCTGGCACAGACCAAG
GCAAAGCACCGTACTGCCTGACCGAAGAATTCGTATCAGTCTACCGCCTCCACTCTCTCCTTCCCGACGACGTTGCATTCTTCAATCTCAAGACCGGCACCCACACCCAAACCGTCCCGA
TCGAACAGGTCTCCTTCGAACACGCCCGCTCCCAATTCGATCCTCAAGACAAGTCCAAGCAGCTTGGCTTCACCGACGCCTTCTACTCTTTCGGAATCAATTATCCAGGCGCCATTCGCA
TCAACAACATGCCCAAATTCCTTCGCGACCTCAAGAAGCCCGACGGAGAACACCTCGACATGGGAGCCGTCGATGTCCTTCGAGACCGTGAGCGAGGCGTGCCCCGGTACTGCCAGTTCC
GCCGTCTCTTCCACATGTCAGCACCCAAGAATTTCGAAGCTTTGACGGGAGGTGACAAGAAGCTCGCAGTCGAACTCTCACAAATCTACGAAGGCGACGTCGAAAAGGTCGATCTCCTCA
TCGGTTGTCTCTGCGAGCCTTTGCCCCAAGGATTTGGCTTCTCCGAGACTCAATTCCGAGTGTTCATCTTGATGGCAAGTCGGAGATTGAAGAGCGATCGTTTCATCGCAAGCGATTTCA
AACAAGAGATGTATACTCGCGAGGGCATTGAATGGGTCCAGAGCAATACCATGAGAGACGTCCTCATCAGGCACTTTCCGGATCTGCGAGGTCCCTTGCGAGATGTCAAGAATGCTTTCG
CGCCTTGGGGCAAGGTTGGCAAGAGTGGTGAGCATTTTGGCAAGGAGGTCTCTACGAGAGATGAGCTGGAGAAGGCTGGATTGCTGAGCTTACTCAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTACACTTGTGCTCAGGCCTCCTTGGTCGCCTTTTTCAAGTTCATCAACACCTTCATATCATGGCACAAGCTGCCGCCTCTCATTGGAGCCCTGAATCTCCTGGCTCTTCGAGAT
GAGCTGCGCGAGAAGAACTTGGTCGACACATATCCCTCGGAGCAGTTCCAGGGTCCTGCACAGAGCGATGTGTTGACCGACACCAAATTTATCTGTGCCCGCAACTCCGATGGGCTTTAC
AATGATCTGGACAAGCCCAAGATGGGCTGCAGAGGAATGCGATTCGGTCGCAACGTCCCGCGAAAGTTCACTGAAAAGCCAAGCGATTTCGACCTGATGCACCCAGATCCACGACTCATC
AGTCAGAAGCTGCTCCAGAGGACAGAGTTCCAAGGCGCCTACATTGTCAATCTCCTCGCCGCTGCCTGGATTCAGTTTCAGGTGCACGACTGGGCACAGCATACGAATAGCAAAACCAAA
TTCCACGAGATCAAGCTCAAGTCGGATGACCCATGGCCGGACCACCCAATGAAAGTCGCCAAGACGGTACAGGATGAGGTACTGGATGATCAGGATCGCAAGTATCCCGCTTACGCCAAT
GAGAACACTCACTG
GTGGGACGCTTCGCAAATCTACGGGTCCACTGAAGCAGAGACACGGCTTCTTCGCAGCAAACATGACGATGGCACCATGGACGTTGATCGATTCCAAGGCGAACAA
TTCTTGCCACGAGGCGTTGATAACATTCCCTTGACAGGCTTTAACCATAATTGGTGGCTCGGTCTGGAGCTACTACACACTCTCTTCGCCTTGGAACACAATGCGATCTGTAGCATGCTC
AAGACCAAGAATCCGAGCTGGACTGGAGATGAACTTTTTGATGTAGCTCGACTGATCAATTGTGCCCTGATGGCGAAAATCCACACCATTGAATGGACTCCAGCAATTTTGCCACATCCG
ACCTTGGGCATTGGCATGAATGCCAACTGGAGTG
CTTTCACCGGCATTCCAGAATCTGGCACAGACCAAGGCAAAGCACCGTACTGCCTGACCGAAGAATTCGTATCAGTCTACCGCCTC
CACTCTCTCCTTCCCGACGACGTTGCATTCTTCAATCTCAAGACCGGCACCCACACCCAAACCGTCCCGATCGAACAGGTCTCCTTCGAACACGCCCGCTCCCAATTCGATCCTCAAGAC
AAGTCCAAGCAGCTTGGCTTCACCGACGCCTTCTACTCTTTCGGAATCAATTATCCAGGCGCCATTCGCATCAACAACATGCCCAAATTCCTTCGCGACCTCAAGAAGCCCGACGGAGAA
CACCTCGACATGGGAGCCGTCGATGTCCTTCGAGACCGTGAGCGAGGCGTGCCCCGGTACTGCCAGTTCCGCCGTCTCTTCCACATGTCAGCACCCAAGAATTTCGAAGCTTTGACGGGA
GGTGACAAGAAGCTCGCAGTCGAACTCTCACAAATCTACGAAGGCGACGTCGAAAAGGTCGATCTCCTCATCGGTTGTCTCTGCGAGCCTTTGCCCCAAGGATTTGGCTTCTCCGAGACT
CAATTCCGAGTGTTCATCTTGATGGCAAGTCGGAGATTGAAGAGCGATCGTTTCATCGCAAGCGATTTCAAACAAGAGATGTATACTCGCGAGGGCATTGAATGGGTCCAGAGCAATACC
ATGAGAGACGTCCTCATCAGGCACTTTCCGGATCTGCGAGGTCCCTTGCGAGATGTCAAGAATGCTTTCGCGCCTTGGGGCAAGGTTGGCAAGAGTGGTGAGCATTTTGGCAAGGAGGTC
TCTACGAGAGATGAGCTGGAGAAGGCTGGATTGCTGAGCTTACTCAAGTGA

Retrieve as FASTA