Entry information : AbraPGHS
Entry ID 10745
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AbraPGHS
Name AbraPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Alternaria
Organism Alternaria brassicicola    [TaxId: 29001 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbraPGHS
start..stop
S start..stop
PnoPGHS01 857 0 200..763 36..623
RrufPGHS 769 0 205..763 38..624
NcPGHS01 684 0 205..763 63..651
NtetPGHS01_2509 683 0 205..763 62..650
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 377067..377081 15 N° 2 377137..377223 87 N° 3 377374..377395 22 N° 4 377673..377940 268
N° 5 378004..378134 131 N° 6 378623..378654 32 N° 7 378991..379047 57 N° 8 379507..380352 846
N° 9 380446..381214 769 N° 10 381270..381334 65  
join(377067..377081,377137..377223,377374..377395,377673..377940,378004..378134, 378623..378654,378991..379047,379507..380352,380446..381214,381270..381334)


exon

Literature and cross-references AbraPGHS
DNA ref. JGI genome:   Contig16 (377067..381334)
Cluster/Prediction ref. JGI gene:   10059
Protein sequence: AbraPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   764 (749)
PWM (Da):   %s   85016.88 (83500.1) Transmb domain:   %s   o59-81i88-110o (o45-67i74-96o)
PI (pH):   %s   7.54 (7.57) Peptide Signal:   %s   cut: 15 range:15-763
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVALLLTWGLCACNHYQFFFGSGAQNLSEIISKTALTFGKDKGAGHCFDLKIVFYWQAGWSMGSDIVILLLPMPVLFSLRMRRAKRLSIVAVFAVSLLIPIASGVRLWGLYLWANSGRHARDYGGYIIFWSQVEINTAIICASAPTIQPLFKRVFSRICCYQPSRSPSYYHGPLHHYARQPKKAEGDPLGRLREHVRELKDGIGVLNVAAFRYELRQKNLHDVYPSPNDQGTLGCPHLSDEQYLHTRHSNGLFNDLSAPKMGCTGMRFGRNVPGEHTAKPSEEELMTPNPRLISEQLLKRDTFKPATSLNLLAAAWIQFQVHDWFQHENSASETYNVPISQGDKWSSSDGKMKIEQTQPDIALNETDKTAPAYKNINTHWWDGSQIYGSSEIRTTKLRGQAKNGKLTVDAQKIATFLPRDENGIPQTGFMTNWWLALEMLHTLFVLEHNAICDALVATYPSWSSEEIFDTARLVNCALMAKIHLLGRVSATSEAISGIPGSDVEHHAAPYALTEGFASVYRMHALIPDTVAFFSAQSGEHKITHPIRDIAFESARAPLEIDAMDFADVFYSFGVNYPGAVTLNNTPDFLRDLHTPDGRHMDLSTVDVLRDRERGVPRYNAFRRLFHLQAASSFLDLTGGNEVIARKLAAVYEDDVAKVDLLVGCIAEPLPAGFGFSDTAVRVFILMASRRPKSDRFIAGGWNEETYSKVGMRWAQDDGMKNVLGRHFPGLEGVLGRSGDSFAPWTMLDASKRYGGKETNA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). Splicing prediction need to be verified.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTTGCACTGGTGAGTAAGGGACCCCGTTGGCGATATAAGCCTGGATGAAGCTAATGGATTGAAGCTTTTGACCTGGGGCCTCTGCGCTTGTAACCATTACCAATTTTTCTTCGG
TTCTGGTGCTCAGAATTTATCAGAGATTATATCAAAG
GTGAGCACAAGTGCCTTCCCCACTACAGTATCCCGTGGTGCCATGCTAACGGATAACTGAAGCCTGTACAAGAGAAGAACAAT
GCATACTTGGAGTACTGGTTGTTTGGCTCTGTAGCATCTTGTGAGCAACTGTCCTAACCTGAGGTAGACTGCGCTAACCTTCGGAAAGGGTACGCATACCACATCGGCTACTTATTTATA
ATGGGCCTCATAAAACTCTCGATCCTTTTTTGTGAGTAACACGGCAAGAATATTCATCCAATACGTGCACTAACCTAGTCATTCCATCCATAGTTTATCTTGGTTTCGCGACACAACGAG
CCTTTCGAAGACTTGTTAAAACATCGATCGTCATCATTGCCGTGATCAGCATCTGCTGCATCTTTATCATCGCCTTTCAATGCCCCAAGGTCCCTTCTTACGCCTTCTCCACTACGATGC
TCATAGACAAAGGTGCTGGCCACTGTTTTGATCTGAAGATCGTCTTCTACTGGCAAGCAGGCTGGAGTATGGGGTCTGACATCGTCATCCTGCTTCTTCCTATGCCGGTTTTGTTTTCAT
TGCGCATGAGAAGAGCCAAGCGATTATCCATCGTTGCGGTCTTTGCGGTGAGTCTACTCATTCCGATAGCGTCTGGAGTTCGACTTTGGGGCCTGTACCTCTGGGCAAATAGCGGGAGAC
ACGCTAGGGACTACGGCGGATACATCATCTTCTG
GTGAGCAAGCTCGTCTACGACGTAAACACTAGGCCGATACTGATACTCTGTTCTTACATATAGGTCCCAGGTTGAGATCAACACAG
CAATTATCTGCGCCTCCGCTCCAACTATTCAGCCACTCTTCAAACGCGTGTTCAGCAGAATATGTTGCTACCAACCATCTCGCAGCCCGTCTTACTACCACGGAGGAC
GTACGTCTCTGC
CCGGACTCCCCCCTGCGGAGATGGAGAGGAATTTGCGAAGAGACAGCATTAGTACCTTGGGGACACCAGATCGGGCCTACTGCCCTTCCAGAAATCAAGGAAACGTTGAATTCGAGGATC
GAGGGATCTCCGCATATACTGCGGAGGAGGAAATTAGAGCACGAATCCGCGCGCTTTCACATCCACCGTCTACACACCTACTTCCGGCTTGCCCATCTTCCGTATACTCAGCCTCTCCAG
TTGCTCTGCATCCAAGCAGCCTGCTAAGGTGTGGCTGATACTTCACACCATACCGTGTGCTCTCACCTAGGAGCGCCTCCCACTGTCGGGCACATGCGAGATTTTAGCACAGTAACATGT
GCATATTGAACAGAGACAAGGAAAGCGCAAGGCTCTTCGCACTTGCTTTAAATAGCAGTAAGAGCCTTTCCATTTTGTGCAATTATACGACTAGAATCTTAACTGTTAGAACGCAGCCCT
GCACCACTACGCCAGGCAACCCAAAAAG
GTACGTATGATCAGTAGACTACTGATCAGGGTGCAGGATAGTAAATATCGTCAGTTGGACCTAACATTAACGAGCTTCGGAGTGGGTCACAT
AGGCATCTACTTAGTTACAGAGTGTATACGTCCGATTCAGCCACCAAGTGCGACTCGAGAGTTGATTTGAGTACTTGTTGCATGGATCCTTGCTGGTTCGTCAGCTGCCAACACCACTCG
TTCGAGCGAAACTCGGTTCAAGGATGAGGTAAGCCGCTTCCGAAAACCCAGTACTATGGGACCTGGAGACATGTAATTGATCTACACAGCCCGGCCAATGTAAGATTGTTCGAAACCGCC
GCAGGCTGAGGGCGATCCATTGGGAAGACTGCGCGAACATGTCCGCGAGCTGAAAGACGGAGTAAGATGGATGTATAGGATCTTGCATGTCTTGCAGCTTTGGTGTTGCGAAGACGATCA
ATTATTGGATGAGCTGATGTATGTATTACGCTCTCTCTTGAAAAAGCGAATCATTGATTCGAACACGCGGTTACGATTGGCATGTCTTGCTTTGGGGCTGAGAAAGGACCTCAGTCCTAT
CGTCCCGGATGCGACGCCAACTGTGCGAATATTGTAAGCCTCTATTATGTTTTAACTGAGCCCTTCCGACATATCTCGTCATTTTCTCTCTTGTTTCATAAATGTCCAAAGGACACGGAG
CTACCAAGAACTCAACTTTCTACGTGTCACAGCCATGGGTCTCTCAAAGGAACCTGGGCACAAAGCCTACACTTACATGCCAGGCCTTCCCCAACGCGCACTCATAGCCATCTTTCATAG
CGTGCATAACATCATTCCATGGCACAAGCTGCCCACCTAGATCGGTGTCCTCAATGTCGCCGCCTTCCGTTACGAACTACGCCAAAAGAACCTACACGATGTCTATCCATCTCCCAACGA
CCAAGGTACTCTTGGATGTCCACACTTATCCGATGAGCAGTACTTGCACACTCGCCACTCCAATGGCCTGTTCAACGATCTCTCGGCTCCAAAGATGGGCTGCACAGGTATGCGATTCGG
CCGTAATGTACCTGGCGAACACACCGCAAAGCCAAGCGAGGAGGAACTCATGACCCCAAATCCCCGACTCATCAGTGAGCAGCTATTGAAGAGAGACACATTCAAGCCTGCTACGAGTTT
GAATCTACTTGCCGCAGCGTGGATTCAATTCCAAGTCCACGACTGGTTTCAGCACGAAAACTCTGCCTCCGAAACGTACAATGTCCCCATTTCTCAAGGCGACAAATGGAGTTCATCAGA
CGGAAAGATGAAGATTGAACAGACACAGCCGGATATCGCACTCAACGAGACGGACAAGACAGCTCCAGCATACAAAAACATCAACACACACTGGTGGGACGGCAGTCAAATCTATGGCAG
CAGCGAAATCCGCACAACCAAACTACGCGGTCAAGCCAAAAACGGTAAACTCACCGTGGACGCCCAGAAGATAGCCACATTCCTTCCCCGAGACGAAAACGGGATCCCCCAGACCGGCTT
CATGACAAACTGGTGGCTAGCCCTAGAAATGCTGCACACGCTCTTCGTCCTCGAGCACAACGCCATCTGCGACGCACTCGTAGCCACCTACCCATCCTGGAGCAGCGAGGAAATCTTCGA
CACAGCCCGCCTAGTCAACTGCGCATTAATGGCCAAGATACACACG
GTAGAGTGGACACTGGCCATCCTCGCGCACCCCATCCTCGAGATAAGCATGAGCGCAAACTGATGGGGTGTCCT
AGGCGAGCGTTTATACAAGCTACTCGGCCGCGTATCCGCCACTTCAGAAGCCATCTCTGGGATTCCGGGGTCGGACGTGGAGCACCACGCCGCGCCCTATGCACTTACCGAGGGGTTTGC
AAGCGTGTATCGTATGCACGCCCTCATCCCCGATACCGTCGCCTTCTTCTCTGCGCAGAGTGGCGAACACAAGATCACGCATCCCATCCGCGACATTGCCTTCGAAAGCGCCAGAGCGCC
CTTGGAAATCGACGCCATGGATTTCGCAGACGTGTTCTACAGCTTCGGAGTAAACTACCCGGGTGCTGTTACGCTGAACAACACACCTGATTTCCTACGCGATTTGCATACACCGGATGG
CCGGCACATGGATCTGAGCACCGTTGATGTGCTGAGAGATAGGGAGAGGGGTGTACCGCGATATAATGCCTTTCGTCGGCTTTTCCACCTACAAGCCGCTTCCTCGTTTCTCGACCTCAC
GGGCGGGAACGAGGTTATTGCGCGCAAACTGGCAGCCGTCTACGAGGACGATGTTGCGAAGGTGGATTTACTGGTTGGCTGTATTGCGGAGCCACTGCCGGCGGGCTTTGGGTTTAGCGA
TACGGCGGTTCGTGTGTTTATCCTAATGGCTAGTCGGAGGCCGAAGAGTGATCGTTTTATTGCGGGAGGCTGGAATGAGGAGACGTACAGTAAGGTTGGTATGCGGTGGGCGCAAGACGA
TGGGATGAAGAATGTGCTGGGGAGACATTTTCCAGGGTTGGAGGGTGTGTTGGGGAGGAGTGGGGATT
GTAAGTTTTACCATGTCTTGGGCAAGGGCGGAGATGATGCTAACACGGGAAA
CAGCTTTTGCGCCTTGGACTATGTTGGACGCGAGTAAGAGGTATGGAGGAAAGGAGACGAATGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTTGCACTGCTTTTGACCTGGGGCCTCTGCGCTTGTAACCATTACCAATTTTTCTTCGGTTCTGGTGCTCAGAATTTATCAGAGATTATATCAAAGACTGCGCTAACCTTCGGA
AAGG
ACAAAGGTGCTGGCCACTGTTTTGATCTGAAGATCGTCTTCTACTGGCAAGCAGGCTGGAGTATGGGGTCTGACATCGTCATCCTGCTTCTTCCTATGCCGGTTTTGTTTTCATTG
CGCATGAGAAGAGCCAAGCGATTATCCATCGTTGCGGTCTTTGCGGTGAGTCTACTCATTCCGATAGCGTCTGGAGTTCGACTTTGGGGCCTGTACCTCTGGGCAAATAGCGGGAGACAC
GCTAGGGACTACGGCGGATACATCATCTTCTG
GTCCCAGGTTGAGATCAACACAGCAATTATCTGCGCCTCCGCTCCAACTATTCAGCCACTCTTCAAACGCGTGTTCAGCAGAATATGT
TGCTACCAACCATCTCGCAGCCCGTCTTACTACCACGGAGGAC
CCCTGCACCACTACGCCAGGCAACCCAAAAAGGCTGAGGGCGATCCATTGGGAAGACTGCGCGAACATGTCCGCGAG
CTGAAAGACGGA
ATCGGTGTCCTCAATGTCGCCGCCTTCCGTTACGAACTACGCCAAAAGAACCTACACGATGTCTATCCATCTCCCAACGACCAAGGTACTCTTGGATGTCCACACTTA
TCCGATGAGCAGTACTTGCACACTCGCCACTCCAATGGCCTGTTCAACGATCTCTCGGCTCCAAAGATGGGCTGCACAGGTATGCGATTCGGCCGTAATGTACCTGGCGAACACACCGCA
AAGCCAAGCGAGGAGGAACTCATGACCCCAAATCCCCGACTCATCAGTGAGCAGCTATTGAAGAGAGACACATTCAAGCCTGCTACGAGTTTGAATCTACTTGCCGCAGCGTGGATTCAA
TTCCAAGTCCACGACTGGTTTCAGCACGAAAACTCTGCCTCCGAAACGTACAATGTCCCCATTTCTCAAGGCGACAAATGGAGTTCATCAGACGGAAAGATGAAGATTGAACAGACACAG
CCGGATATCGCACTCAACGAGACGGACAAGACAGCTCCAGCATACAAAAACATCAACACACACTGGTGGGACGGCAGTCAAATCTATGGCAGCAGCGAAATCCGCACAACCAAACTACGC
GGTCAAGCCAAAAACGGTAAACTCACCGTGGACGCCCAGAAGATAGCCACATTCCTTCCCCGAGACGAAAACGGGATCCCCCAGACCGGCTTCATGACAAACTGGTGGCTAGCCCTAGAA
ATGCTGCACACGCTCTTCGTCCTCGAGCACAACGCCATCTGCGACGCACTCGTAGCCACCTACCCATCCTGGAGCAGCGAGGAAATCTTCGACACAGCCCGCCTAGTCAACTGCGCATTA
ATGGCCAAGATACACACG
CTACTCGGCCGCGTATCCGCCACTTCAGAAGCCATCTCTGGGATTCCGGGGTCGGACGTGGAGCACCACGCCGCGCCCTATGCACTTACCGAGGGGTTTGCA
AGCGTGTATCGTATGCACGCCCTCATCCCCGATACCGTCGCCTTCTTCTCTGCGCAGAGTGGCGAACACAAGATCACGCATCCCATCCGCGACATTGCCTTCGAAAGCGCCAGAGCGCCC
TTGGAAATCGACGCCATGGATTTCGCAGACGTGTTCTACAGCTTCGGAGTAAACTACCCGGGTGCTGTTACGCTGAACAACACACCTGATTTCCTACGCGATTTGCATACACCGGATGGC
CGGCACATGGATCTGAGCACCGTTGATGTGCTGAGAGATAGGGAGAGGGGTGTACCGCGATATAATGCCTTTCGTCGGCTTTTCCACCTACAAGCCGCTTCCTCGTTTCTCGACCTCACG
GGCGGGAACGAGGTTATTGCGCGCAAACTGGCAGCCGTCTACGAGGACGATGTTGCGAAGGTGGATTTACTGGTTGGCTGTATTGCGGAGCCACTGCCGGCGGGCTTTGGGTTTAGCGAT
ACGGCGGTTCGTGTGTTTATCCTAATGGCTAGTCGGAGGCCGAAGAGTGATCGTTTTATTGCGGGAGGCTGGAATGAGGAGACGTACAGTAAGGTTGGTATGCGGTGGGCGCAAGACGAT
GGGATGAAGAATGTGCTGGGGAGACATTTTCCAGGGTTGGAGGGTGTGTTGGGGAGGAGTGGGGATT
CTTTTGCGCCTTGGACTATGTTGGACGCGAGTAAGAGGTATGGAGGAAAGGAG
ACGAATGCGTAG

Retrieve as FASTA