Entry information : BcomPGHS
Entry ID 10746
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: BcomPGHS
Name BcomPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Baudoinia
Organism Baudoinia compniacensis    [TaxId: 430998 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BcomPGHS
start..stop
S start..stop
HpulPGHS 848 0 17..640 8..624
XparPGHS 830 0 17..634 8..624
AtePGHS01 812 0 17..634 5..616
BdotPGHS 808 0 15..640 5..650
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 119251..119450 200 N° 2 118543..119184 642 N° 3 117517..118485 969 N° 4 117308..117452 145
complement(join(117308..117452,117517..118485,118543..119184,119251..119450))


exon

Literature and cross-references BcomPGHS
DNA ref. JGI genome:   scaffold_11 (119450..117308)
Cluster/Prediction ref. JGI gene:   230055
Protein sequence: BcomPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   652
PWM (Da):   %s   73122.64  
PI (pH):   %s   6.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPTMVDQADPVEHESWSFQLSFFENLIVSFFKFVNKHIEWHKLPTLLGVANLLAFRYELRAKNLYDGYASKAPQGTLAAEPLKDKRFLEARSSDGDYNSLEMPKMGCAGMRFGRNIPRSCAKKPSEQEMMTPNPRLISDTLMKRTEPDGFKPATTLNLLAAAWIQFQVHDWFFHEQQTENDYQVPLPPGDDWPSKDGTMALPKSQPDVTLDASDVACPGYKNMCTPWWDASQLYGESEIVTSSLRSKHPDGKLELTQDKKESFLPRDPKTGLPLTGFNNNWWIGLELLHTLFALEHNAVCDLLRAAHPTWTSDQIFDKARLVISCLMAKIHTVEWTPAILAHPALQVAMNTNWWGLVGEKLTKLLGRLSTDDVVSGIPGSGVDQDGVPYSLTEEFVSVYRMHTLIPDNIAFFNATTGSHERTTPFEDVVFAKARDPLDSGVSFADAFYSFGINYPGAITHNNYGAFLRGPMDAGDGVLRDMATVDILRDRERGIPRYCEMRRLLHMTAPKSFLELTGGDEALAKKVEEVYEGDVEKVDLLIGCHCEPLPKGFGFSDTAFRVFILMASRRLKSDRFIANQFDKETYTAEGLHWVQNTTMKDVLIRHFPELAPTLKHQKNVFAPWPQKEASKTYKGPETNAPAPAPTLVAGKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAACCATGGTCGACCAAGCGGACCCGGTCGAACATGAATCGTGGTCGTTTCAGCTTAGTTTCTTTGAGAACCTCATTGTCAGCTTCTTCAAGTTTGTCAACAAGCACATCGAATGG
CATAAGCTTCCCACCTTGCTCGGCGTTGCAAACCTCTTAGCCTTCCGATATGAGTTGCGAGCGAAGAATCTCTACGATGG
GTGAGTTGCCGAGAAACTACACACACCCACTCAGTGTGGG
CTGATGGCGACTCTCATCCGGTGTAGGTATGCATCGAAGGCTCCACAAGGAACCCTGGCCGCGGAGCCATTGAAAGATAAGCGCTTTCTCGAGGCGCGCAGCTCAGATGGCGATTACAAC
TCGCTGGAGATGCCGAAGATGGGCTGCGCGGGCATGCGCTTTGGCCGCAACATCCCACGATCATGCGCCAAGAAGCCATCTGAACAAGAAATGATGACGCCCAACCCAAGGCTGATCAGT
GATACTCTTATGAAGCGGACGGAGCCGGATGGTTTCAAGCCCGCCACCACGCTGAACCTGCTAGCTGCTGCATGGATCCAATTCCAAGTCCACGACTGGTTCTTCCACGAACAGCAAACC
GAGAATGACTATCAAGTCCCTCTCCCGCCGGGCGACGACTGGCCAAGCAAAGATGGCACGATGGCGTTGCCCAAATCCCAGCCCGACGTCACCCTGGACGCTTCCGATGTGGCTTGCCCT
GGCTATAAGAACATGTGCACACCCTGGTGGGACGCTTCACAGCTATACGGCGAAAGCGAGATAGTCACCTCATCTCTACGTTCCAAGCATCCAGACGGCAAACTCGAACTCACACAAGAC
AAGAAAGAGTCCTTCCTGCCTCGAGATCCGAAGACTGGTCTCCCATTGACCGGCTTCAACAACAATTG
GTGAAACTGCAGCATTTCTCACGGCGTAGATCAGTCCACGACTAACGAGAAT
GACAGGTGGATTGGCCTCGAACTCCTCCACACCCTCTTCGCCCTCGAGCACAACGCCGTCTGCGACCTCCTCCGCGCCGCCCACCCAACCTGGACCTCCGACCAAATCTTCGACAAAGCC
CGCCTCGTCATCTCCTGCCTCATGGCCAAAATCCACACCGTCGAATGGACCCCCGCCATCCTCGCCCACCCCGCGCTTCAAGTCGCCATGAACACCAATTGGTGGGGTCTGGTCGGCGAG
AAACTAACCAAACTCCTCGGTCGTCTCAGTACGGATGATGTGGTAAGCGGCATCCCGGGGTCGGGGGTGGACCAGGACGGCGTGCCGTATAGTTTGACGGAGGAGTTTGTGAGTGTCTAT
CGAATGCACACTCTCATCCCGGACAACATCGCCTTCTTCAACGCCACCACGGGTTCGCACGAGCGGACCACGCCATTCGAGGATGTTGTCTTCGCCAAAGCCCGCGATCCTCTCGACAGC
GGGGTCAGTTTCGCCGACGCGTTCTACTCCTTCGGGATCAACTACCCGGGCGCAATCACCCACAACAACTACGGCGCCTTCCTCCGCGGACCCATGGATGCGGGCGATGGCGTGTTGCGG
GATATGGCTACCGTTGATATCCTGCGGGACCGCGAACGCGGGATCCCACGGTATTGCGAAATGAGGCGGTTGCTGCACATGACTGCACCCAAAAGCTTCCTCGAGCTGACGGGGGGTGAT
GAGGCGCTGGCGAAGAAAGTGGAAGAGGTATACGAGGGGGATGTGGAGAAAGTGGATTTGCTGATCGGATGTCATTGTGAACCGCTCCCCAAGGGGTTTGGGTTCTCGGACACGGCGTTC
CGGGTGTTCATCTTAATGGCGAGTCGCCGGCTCAAAAGCGACCGCTTCATCGCCAACCAATTCGACAAAGAAACGTATACGGCTGAAGGACTGCACTGGGTGCAGAATACCACTATGAAG
GATGTCCTGATCAG
GTGAGTTGGAGGGCAAAGCTGCCAGCGGCCGTCCATCCATTCTGACTTCGTTTTTCTTCCACAGACACTTCCCCGAACTAGCCCCAACGCTGAAGCATCAGAAAAA
CGTCTTCGCGCCCTGGCCGCAGAAGGAGGCGAGTAAGACGTACAAAGGGCCTGAGACGAATGCGCCTGCGCCTGCGCCCACGCTTGTTGCGGGCAAGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAACCATGGTCGACCAAGCGGACCCGGTCGAACATGAATCGTGGTCGTTTCAGCTTAGTTTCTTTGAGAACCTCATTGTCAGCTTCTTCAAGTTTGTCAACAAGCACATCGAATGG
CATAAGCTTCCCACCTTGCTCGGCGTTGCAAACCTCTTAGCCTTCCGATATGAGTTGCGAGCGAAGAATCTCTACGATGG
GTATGCATCGAAGGCTCCACAAGGAACCCTGGCCGCGGAG
CCATTGAAAGATAAGCGCTTTCTCGAGGCGCGCAGCTCAGATGGCGATTACAACTCGCTGGAGATGCCGAAGATGGGCTGCGCGGGCATGCGCTTTGGCCGCAACATCCCACGATCATGC
GCCAAGAAGCCATCTGAACAAGAAATGATGACGCCCAACCCAAGGCTGATCAGTGATACTCTTATGAAGCGGACGGAGCCGGATGGTTTCAAGCCCGCCACCACGCTGAACCTGCTAGCT
GCTGCATGGATCCAATTCCAAGTCCACGACTGGTTCTTCCACGAACAGCAAACCGAGAATGACTATCAAGTCCCTCTCCCGCCGGGCGACGACTGGCCAAGCAAAGATGGCACGATGGCG
TTGCCCAAATCCCAGCCCGACGTCACCCTGGACGCTTCCGATGTGGCTTGCCCTGGCTATAAGAACATGTGCACACCCTGGTGGGACGCTTCACAGCTATACGGCGAAAGCGAGATAGTC
ACCTCATCTCTACGTTCCAAGCATCCAGACGGCAAACTCGAACTCACACAAGACAAGAAAGAGTCCTTCCTGCCTCGAGATCCGAAGACTGGTCTCCCATTGACCGGCTTCAACAACAAT
TG
GTGGATTGGCCTCGAACTCCTCCACACCCTCTTCGCCCTCGAGCACAACGCCGTCTGCGACCTCCTCCGCGCCGCCCACCCAACCTGGACCTCCGACCAAATCTTCGACAAAGCCCGC
CTCGTCATCTCCTGCCTCATGGCCAAAATCCACACCGTCGAATGGACCCCCGCCATCCTCGCCCACCCCGCGCTTCAAGTCGCCATGAACACCAATTGGTGGGGTCTGGTCGGCGAGAAA
CTAACCAAACTCCTCGGTCGTCTCAGTACGGATGATGTGGTAAGCGGCATCCCGGGGTCGGGGGTGGACCAGGACGGCGTGCCGTATAGTTTGACGGAGGAGTTTGTGAGTGTCTATCGA
ATGCACACTCTCATCCCGGACAACATCGCCTTCTTCAACGCCACCACGGGTTCGCACGAGCGGACCACGCCATTCGAGGATGTTGTCTTCGCCAAAGCCCGCGATCCTCTCGACAGCGGG
GTCAGTTTCGCCGACGCGTTCTACTCCTTCGGGATCAACTACCCGGGCGCAATCACCCACAACAACTACGGCGCCTTCCTCCGCGGACCCATGGATGCGGGCGATGGCGTGTTGCGGGAT
ATGGCTACCGTTGATATCCTGCGGGACCGCGAACGCGGGATCCCACGGTATTGCGAAATGAGGCGGTTGCTGCACATGACTGCACCCAAAAGCTTCCTCGAGCTGACGGGGGGTGATGAG
GCGCTGGCGAAGAAAGTGGAAGAGGTATACGAGGGGGATGTGGAGAAAGTGGATTTGCTGATCGGATGTCATTGTGAACCGCTCCCCAAGGGGTTTGGGTTCTCGGACACGGCGTTCCGG
GTGTTCATCTTAATGGCGAGTCGCCGGCTCAAAAGCGACCGCTTCATCGCCAACCAATTCGACAAAGAAACGTATACGGCTGAAGGACTGCACTGGGTGCAGAATACCACTATGAAGGAT
GTCCTGATCAG
ACACTTCCCCGAACTAGCCCCAACGCTGAAGCATCAGAAAAACGTCTTCGCGCCCTGGCCGCAGAAGGAGGCGAGTAAGACGTACAAAGGGCCTGAGACGAATGCGCCT
GCGCCTGCGCCCACGCTTGTTGCGGGCAAGAAGTAG

Retrieve as FASTA