Entry information : BdotPGHS
Entry ID 10747
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-10-15 (Catherine Mathe (Scipio))
Peroxidase information: BdotPGHS
Name BdotPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Botryosphaeria
Organism Botryosphaeria dothidea    [TaxId: 55169 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdotPGHS
start..stop
S start..stop
HpulPGHS 928 0 8..652 9..626
XparPGHS 901 0 5..644 6..624
AtePGHS01 900 0 1..644 1..616
NcPGHS01 869 0 8..649 34..651
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37774..38738 965 N° 2 38788..39074 287 N° 3 39133..39835 703 N° 4 39922..40000 79
N° 5 40047..40211 165  
join(37774..38738,38788..39074,39133..39835,39922..40000,40047..40211)


exon

Literature and cross-references BdotPGHS
DNA ref. JGI genome:   NODE_11999_length_44749_cov_63.777962 (37774..40211)
Cluster/Prediction ref. JGI gene:   1291
Protein sequence: BdotPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   732
PWM (Da):   %s   82610.51  
PI (pH):   %s   7.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSPTYQYHPSLLERFLVKTFQIVNKFVQWHKLPGIVGAINLDAMRIELREHNLHDGYASTAAQGNPHDPPLTNKRYLNTRNSDGIFNSLDQPRMGGACMRFGRNFPRKYTQKPSEEELWIPNPRLLSERIMTRKPGGFKPATSLNLLAAAWIQFQTHDWFNHENVSAMIFSISLATINGTHKIPTKSEGDSYDIPLPARDKWPGGHMKLPKTTPDDVLDPSDVVCPGYKNTLTAWWDGSQIYGSSEEVTKKLRGQNPDGKLTLIPIGDGVGFYLPRNSENEPETGFSNNWWTGMEMLHTLFAMEHNAICDMLHKAYPDWTGDQIFDKARLVNSALMAKIHTVEWTPAILAHPALQIAMNANWWGLVGENLTKMVGRISRTSEAISGIPGSTAVQFSAPYSLTEEFVSVYRMHSLVDSIAFFDADSGKHHESVPTEELTFTDAQRPFNDGLSMADAFYSFGINYPGAITNKNYPNFLRNLTTPDGLHRDMGTVDILRDRERGVPRYTQFRRLLRMSVPKTFEELTGGDKELANELSDLYNGDIELVDTLVGSQCEPLPKGFGFSDTAFRIFILMASRRLKSDRFIAGQWNKETYTKEGFHWVQYSGMKDVLARHFPELESILGKSKNAFAPWDKLEGSRGYTGPETNAPKVVQHNTYFLLVRMQLVARIKIFRDDNKIVIPECTVRLAPGEFLEGLAQMGSGEFPYRWTSTTVSSRVKVHNIRIKSWAPD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns). Splicing prediction need to be verified.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCAACTTATCAATATCATCCTTCCTTGCTCGAGCGCTTCTTGGTCAAGACATTTCAGATTGTCAATAAATTCGTACAATGGCACAAGCTCCCCGGCATAGTTGGCGCGATC
AACCTGGATGCCATGCGCATCGAGCTGCGGGAACACAATCTCCATGACGGCTACGCATCGACTGCTGCTCAAGGAAACCCGCATGATCCACCATTGACAAACAAACGATACTTAAATACA
CGCAACTCGGATGGCATATTCAACTCACTGGATCAACCGCGGATGGGTGGAGCATGCATGCGGTTTGGACGCAATTTTCCCAGAAAATACACTCAGAAGCCTTCTGAAGAAGAGCTTTGG
ATACCAAATCCAAGGTTGCTTAGCGAGCGCATTATGACGAGGAAGCCAGGAGGATTCAAACCTGCCACTTCTCTGAACTTACTCGCTGCGGCATGGATTCAATTCCAGACTCACGATTGG
TTCAACCACGAGAACGTAAGTGCTATGATTTTCTCGATATCTCTTGCTACTATAAATGGTACTCACAAAATCCCCACAAAGAGCGAGGGTGATTCCTACGACATCCCACTCCCAGCGCGA
GACAAATGGCCAGGTGGTCATATGAAACTTCCGAAGACTACTCCTGATGACGTCCTTGATCCATCTGACGTGGTTTGTCCTGGGTACAAGAACACCCTGACGGCTTGGTGGGACGGCTCA
CAGATTTACGGCTCGAGCGAAGAGGTCACGAAGAAGCTACGAGGCCAGAATCCAGACGGAAAGCTAACCTTGATCCCAATCGGAGATGGTGTGGGATTCTACTTGCCTCGAAACTCGGAG
AATGAGCCAGAAACCGGATTCAGCAATAATTGGTGGACCGGAATGGAAATGCTTCACACGTTGTTCGCCATGGAACACAACGCTATCTGCGATATGCTGCACAAGGCCTACCCCGACTGG
ACAGG
GTAATTCTACCGAGCCCCTGTTGGATACTGGATTCTGACAGAAGCACAGAGATCAAATTTTCGACAAGGCTCGGCTCGTGAACTCCGCTTTGATGGCCAAGATCCATACGGTCGA
GTGGACTCCAGCAATTCTAGCACACCCAGCTTTGCAAATAGCAATGAACGCAAATTGGTGGGGCCTTGTTGGGGAAAATTTGACCAAGATGGTTGGCCGGATATCGAGGACCAGCGAAGC
CATCAGTGGCATTCCCGGCTCTACCGCAGTTCAATTCAGTGCTCCATATTCTTTGACAGAGGAGTTTGTGTCCGTATACCGAATGCACTCTTTGGTCCCCG
GTAAGCACGAATATCCTGA
TTCAAAATTACGACAGGATCTACTGACATTATTGCAAAGATAGCATTGCTTTCTTCGATGCAGACAGCGGCAAGCATCACGAAAGCGTTCCTACGGAGGAATTGACCTTTACCGACGCCC
AGCGGCCCTTCAACGATGGTCTGTCTATGGCTGATGCCTTCTATTCCTTTGGCATCAACTATCCAGGCGCCATCACGAACAAGAACTACCCTAATTTTCTCAGAAACTTGACAACTCCGG
ATGGCTTACACCGTGATATGGGAACGGTAGATATTCTGCGTGACCGCGAGCGTGGTGTGCCTCGGTATACTCAATTTCGACGGCTCTTACGAATGTCTGTTCCAAAGACGTTTGAGGAAC
TAACGGGAGGAGACAAAGAGCTGGCGAATGAGCTTTCTGACCTGTACAACGGCGACATCGAGTTGGTTGATACTTTAGTAGGCTCACAGTGCGAGCCTCTACCCAAAGGATTTGGGTTCA
GTGACACGGCATTTCGGATTTTTATCCTGATGGCAAGCAGGCGGTTGAAGAGCGACCGTTTCATTGCGGGGCAGTGGAATAAAGAGACGTACACTAAAGAAGGATTCCATTGGGTGCAGT
ATTCAGGGATGAAGGACGTGCTCGCGAGGCATTTTCCGGAGTTGGAAAGTATTTTGGGAAAGAGCAAAAACGCATTTGCACCATGGGACAAGCTAGAGGGGTCGCGCGGGTACACTGGGC
CTGAGACAAATGCTCCGAAGGT
GTAAGTTGGAATGGCTTATTGGGTTACGCCGGGAACATCTTGCTTTGTAGTATACTCTTCTTCAATCGTAACGTTAATACGCGTAGGGTACAACACAA
CACATATTTTCTTCTTGTGCGGATGCAATTGGTGGCCCGAATAAAAATTTTCCGTGACGATAATCCG
GTTCCTGCGAAGTCGAGCCGAGAAATTGTAATGCTATTGCGTTTAGAAGATTG
TCATCCCGGAGTGCACTGTGAGACTCGCCCCTGGTGAATTCCTGGAGGGACTCGCGCAAATGGGTTCTGGCGAATTCCCCTACCGTTGGACATCGACGACGGTCTCTTCGCGAGTGAAAG
TCCACAACATTAGGATCAAGTCCTGGGCGCCTGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCAACTTATCAATATCATCCTTCCTTGCTCGAGCGCTTCTTGGTCAAGACATTTCAGATTGTCAATAAATTCGTACAATGGCACAAGCTCCCCGGCATAGTTGGCGCGATC
AACCTGGATGCCATGCGCATCGAGCTGCGGGAACACAATCTCCATGACGGCTACGCATCGACTGCTGCTCAAGGAAACCCGCATGATCCACCATTGACAAACAAACGATACTTAAATACA
CGCAACTCGGATGGCATATTCAACTCACTGGATCAACCGCGGATGGGTGGAGCATGCATGCGGTTTGGACGCAATTTTCCCAGAAAATACACTCAGAAGCCTTCTGAAGAAGAGCTTTGG
ATACCAAATCCAAGGTTGCTTAGCGAGCGCATTATGACGAGGAAGCCAGGAGGATTCAAACCTGCCACTTCTCTGAACTTACTCGCTGCGGCATGGATTCAATTCCAGACTCACGATTGG
TTCAACCACGAGAACGTAAGTGCTATGATTTTCTCGATATCTCTTGCTACTATAAATGGTACTCACAAAATCCCCACAAAGAGCGAGGGTGATTCCTACGACATCCCACTCCCAGCGCGA
GACAAATGGCCAGGTGGTCATATGAAACTTCCGAAGACTACTCCTGATGACGTCCTTGATCCATCTGACGTGGTTTGTCCTGGGTACAAGAACACCCTGACGGCTTGGTGGGACGGCTCA
CAGATTTACGGCTCGAGCGAAGAGGTCACGAAGAAGCTACGAGGCCAGAATCCAGACGGAAAGCTAACCTTGATCCCAATCGGAGATGGTGTGGGATTCTACTTGCCTCGAAACTCGGAG
AATGAGCCAGAAACCGGATTCAGCAATAATTGGTGGACCGGAATGGAAATGCTTCACACGTTGTTCGCCATGGAACACAACGCTATCTGCGATATGCTGCACAAGGCCTACCCCGACTGG
ACAGG
AGATCAAATTTTCGACAAGGCTCGGCTCGTGAACTCCGCTTTGATGGCCAAGATCCATACGGTCGAGTGGACTCCAGCAATTCTAGCACACCCAGCTTTGCAAATAGCAATGAAC
GCAAATTGGTGGGGCCTTGTTGGGGAAAATTTGACCAAGATGGTTGGCCGGATATCGAGGACCAGCGAAGCCATCAGTGGCATTCCCGGCTCTACCGCAGTTCAATTCAGTGCTCCATAT
TCTTTGACAGAGGAGTTTGTGTCCGTATACCGAATGCACTCTTTGGTCCCCG
ATAGCATTGCTTTCTTCGATGCAGACAGCGGCAAGCATCACGAAAGCGTTCCTACGGAGGAATTGACC
TTTACCGACGCCCAGCGGCCCTTCAACGATGGTCTGTCTATGGCTGATGCCTTCTATTCCTTTGGCATCAACTATCCAGGCGCCATCACGAACAAGAACTACCCTAATTTTCTCAGAAAC
TTGACAACTCCGGATGGCTTACACCGTGATATGGGAACGGTAGATATTCTGCGTGACCGCGAGCGTGGTGTGCCTCGGTATACTCAATTTCGACGGCTCTTACGAATGTCTGTTCCAAAG
ACGTTTGAGGAACTAACGGGAGGAGACAAAGAGCTGGCGAATGAGCTTTCTGACCTGTACAACGGCGACATCGAGTTGGTTGATACTTTAGTAGGCTCACAGTGCGAGCCTCTACCCAAA
GGATTTGGGTTCAGTGACACGGCATTTCGGATTTTTATCCTGATGGCAAGCAGGCGGTTGAAGAGCGACCGTTTCATTGCGGGGCAGTGGAATAAAGAGACGTACACTAAAGAAGGATTC
CATTGGGTGCAGTATTCAGGGATGAAGGACGTGCTCGCGAGGCATTTTCCGGAGTTGGAAAGTATTTTGGGAAAGAGCAAAAACGCATTTGCACCATGGGACAAGCTAGAGGGGTCGCGC
GGGTACACTGGGCCTGAGACAAATGCTCCGAAGGT
GGTACAACACAACACATATTTTCTTCTTGTGCGGATGCAATTGGTGGCCCGAATAAAAATTTTCCGTGACGATAATCCGAAGATT
GTCATCCCGGAGTGCACTGTGAGACTCGCCCCTGGTGAATTCCTGGAGGGACTCGCGCAAATGGGTTCTGGCGAATTCCCCTACCGTTGGACATCGACGACGGTCTCTTCGCGAGTGAAA
GTCCACAACATTAGGATCAAGTCCTGGGCGCCTGACTAA

Retrieve as FASTA