Entry information : CposLDS03_silveira
Entry ID 10752
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-12 (Christophe Dunand)
Peroxidase information: CposLDS03_silveira
Name CposLDS03_silveira
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Coccidioides
Organism Coccidioides posadasii    [TaxId: 199306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CposLDS03_silveira
start..stop
S start..stop
CimLDS03 2321 0 1..1114 1..1114
AcapLDS03 1467 0 33..1095 62..1104
AflLDS03 1459 0 47..1107 57..1119
AorLDS03 1449 0 47..1096 57..1108
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46323..46682 360 N° 2 46738..46835 98 N° 3 46901..47142 242 N° 4 47194..47398 205
N° 5 47459..47599 141 N° 6 47651..47741 91 N° 7 47792..48131 340 N° 8 48189..48532 344
N° 9 48619..49151 533 N° 10 49203..49617 415 N° 11 49697..50216 520 N° 12 50271..50326 56
join(46323..46682,46738..46835,46901..47142,47194..47398,47459..47599,47651..477 41,47792..48131,48189..48532,48619..49151,49203..49617,49697..50216,50271..50326 )


exon

Literature and cross-references CposLDS03_silveira
DNA ref. GenBank:   GL636515.1 (46323..50326)
Protein sequence: CposLDS03_silveira
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1114
PWM (Da):   %s   125236.35  
PI (pH):   %s   8.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTTNGHSNGIGHTNGTAAGTKASRNGIDKVNSRKSAVKRPQVESTFKQYAQLIHAARRPLPKQSGDGTYLTGPKAKTSLLQDLRSMGPKGWGTLIAVLKNKRSGDLTDDKTYIMERIIHLVAGLPPESNMRTKLTNSFVTELWNTLPHPSVSAFGDEYMYRSADGSNNNPLFPKLGAANTPYARSIIPSTIQLGALPDPGLIFDSIFAREEFKPHPNGVSSMFFAWASLIIDLFQTDHRNPNISQTSSYLDLSTLYGDNQEDQNQVRTFKDGKLKPDCFSEPRLLALPPVCSVILVMLNRFHNYVAEQLAHINEGGRFSKPRTGLSPEESTKAWAKYDNDLFQTARLVTCGLYINITLYDYVRTIINLTRSNTTWCLDPRVNMRDNATPEAAASGTGNQCSVEFNLAYRWHSCIGQQDERWTEGIYQELFGKPAGEVSMPDLLMGMKKWQTELPKDPSHRSFAGLKRGSDGRFNDDDLVKIMTESTEEIGSFGPRNVPKALRAVEILGIQQARKWGCGSLNEFRKFFGLKEYTTFEEINSDPYIADQLRHLYEHPDHVELYPGIVAEEPKIPMVPGAGICPTYTLSRAILSDAVALVRGDRFYTTDYHPKSLTNWGYSETHYDLNINQGCVFYKLILRSFPNHFKPDSIYAHYPMTIPSENKKIFAGLGRESHFSWEKPAFIPPRVNLTSYLGAKTILDNAKDFRVTWGEATGFLFGTGGLNFMLSGDSPKHAKQRQLMGKALYHEEWKKQVKQFYEDITIKLLRQKSYKVAGVNQVDITDVGNLAHVHFASNIFSLPLKTEKNPRGIYTEHEMFMVMCVVFTCIFFDLDPAKSFPLRQAARVVAQQLGKIVEGYVKSVKATSIISGIVDRFRKNETALKDYGIHMIRRLLASGQSVSEVTWSQVMPTAGAMVPNQAQVFTQIIDYYLSEEGRIHLPEIQRLAHQDTPESDDKLLHYCMEAIRLNGTFGSYREATTAMEIDDDGRHVSIKPGDKVFVSFVSANRDPDIFPNPNEVRLDRPLDSYIHYGEGPHTCLGRDANMVALTSMLRVIGKLKNLRRAPGPQGELKKVPRPGGFYIYMREDHGSYFVFPTFKVHFDGELPEPHSRPA

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCACTACCAATGGTCATTCAAATGGCATCGGCCATACGAACGGGACGGCAGCTGGTACCAAGGCCTCCCGGAATGGCATTGACAAAGTCAATAGTCGCAAGAGTGCTGTCAAGCGC
CCACAAGTCGAGAGTACATTCAAACAATATGCGCAATTGATTCACGCCGCCAGGCGCCCGCTCCCAAAGCAATCCGGTGACGGAACTTATTTGACAGGACCCAAGGCAAAAACTTCTCTT
CTCCAGGACCTGAGGTCGATGGGCCCCAAAGGATGGGGAACTCTGATAGCTGTGCTGAAAAATAAGAGATCCGGTGATCTCACTGATGACAAGACCTACATCATGGAGCGCATAATCCAC
GTATGTTCTTCTCGAACGCTTACTTAGGTTTTCTGTGCTGACTTACTTCGGATAGCTTGTCGCGGGGTTACCGCCAGAGTCAAACATGAGGACCAAGTTGACCAACTCGTTCGTCACCGA
GCTTTGGAATACCCTTCCTCATCCATCAGTATC
GTACGTGCGGCCCACCCCTTTAATATATTTTCTCCTGTTTCACCTCTTCTTACAGATTCCATCAGTGCATTCGGAGACGAATACATG
TACAGATCTGCAGACGGATCTAATAACAATCCCCTGTTTCCAAAACTTGGCGCTGCAAACACTCCATATGCTCGCTCCATCATCCCATCGACGATTCAACTCGGTGCTCTCCCTGATCCA
GGCCTGATTTTTGACAGCATCTTTGCTCGGGAAGAATTCAAACCTCACCCTAACGGTGTTTCCAGCATGTTCTTCGCCTGGGCTTCCCTGATCATTCATG
GTGAGAAATGTCGTACCCTT
TTCCATTAAAGAATGAAGTTAATGTCAGAAGATTTATTCCAAACCGACCATCGAAACCCAAATATCTCTCAGACTTCTTCTTATCTCGATCTTTCAACCCTGTATGGTGACAACCAAGAG
GACCAAAACCAGGTGAGGACCTTCAAGGATGGGAAATTAAAACCGGATTGTTTCTCTGAACCAAGGCTTCTTGCTCTGCCCCCGGTCTGCAGTGTTATTCTAGTTATGCTTAATCG
GTAC
GCTTTTCTCCATACGTTCCTTGCCAGCTGTAAAATGATGACATTTGACACTATTAGATTCCACAATTATGTCGCTGAGCAACTCGCGCATATCAACGAAGGTGGGCGGTTTAGCAAGCCG
AGAACTGGTCTATCGCCTGAGGAATCCACCAAAGCATGGGCCAAATATGACAACGATCTTTTCCAGACAGCCCGACT
GTAAGAGCATTGGTCTCCATCTGTTTTGACGGTTGCTGACAAT
GTGGACAGGGTTACCTGCGGCCTCTACATAAACATTACATTGTACGATTACGTGCGTACAATCATTAATCTAACACGCAGTAACACTACTTGGTGCTTGGTAAGACACAAAGACAGCCCT
TGCCTCGACAACATTGCTAATCTCCCAAGGATCCACGAGTGAACATGCGTGACAACGCCACCCCAGAGGCCGCAGCGAGTGGAACAGGCAATCAATGCTCGGTTGAGTTCAATCTGGCCT
ACCGATGGCATTCTTGCATCGGACAACAAGACGAAAGGTGGACAGAAGGGATATACCAGGAATTGTTTGGAAAACCTGCTGGAGAAGTCTCGATGCCTGATCTCCTGATGGGGATGAAGA
AATGGCAGACCGAATTACCCAAAGACCCGTCTCACAGATCCTTTGCAGGTTTGAAACGTGGCTCTGATGGCCGATTCAACGATGACGACCTTGTGAAGATTATGACCGAAAGCACTGAAG
AAATTGCCG
GTACGTTCATCACCATCCTCCCCGATCAGGTTGTTCATTGTAATAACCCTTTTCTAGGTTCTTTCGGTCCGCGCAATGTTCCAAAAGCACTACGAGCGGTTGAAATTCTCG
GCATTCAACAGGCACGTAAGTGGGGATGTGGCTCCCTCAATGAATTCCGGAAATTCTTCGGGCTTAAGGAGTACACGACCTTCGAAGAAATTAATTCGGATCCTTACATTGCGGATCAAC
TTCGTCATTTATATGAACACCCCGATCACGTTGAACTATACCCTGGTATCGTTGCCGAGGAGCCTAAAATTCCAATGGTCCCTGGTGCAGGAATTTGCCCCACGTATACGCTGTCTCGAG
CCATTCTCTCGGACGCGGTTGCGTTGGTTCGAGGGGACAGGTTCTATACC
GTATGGTTTTTCCCTTTTACCCGCGAGAGAGGATTTTATAATCTAATTTGAAAGAATGCTGAGCGTTGCT
AATTTGATCATTATAGACCGATTACCATCCCAAGAGTCTCACCAACTGGGGCTATTCTGAAACACACTATGATCTGAACATCAATCAAGGCTGTGTATTTTATAAACTCATTCTCAGATC
CTTCCCTAACCACTTTAAGCCAGATTCAATCTATGCCCATTATCCAATGACAATCCCCAGCGAGAACAAGAAAATATTTGCAGGATTGGGCAGAGAATCCCATTTCTCATGGGAAAAGCC
GGCCTTCATTCCCCCCCGTGTCAACTTGACATCATATCTTGGGGCTAAGACCATTCTAGATAATGCGAAAGATTTTCGAGTAACGTGGGGTGAAGCCACTGGCTTCTTATTCGGTACAGG
AGGGTTAAACTTCATGCTTTCTGGAGATTCTCCCAAACATGCGAAGCAAAGACAACTGATGGGTAAAGCGCTTTACCATGAAGAATGGAAGAAACAGGTGAAGCAATTTTATGAGGATAT
CACTATTAAGCTCCTAAGGCAGAAATCCTACAAGGTTGCAGGAGTGAACCAGGTTGATATCACCAGAGA
GTGAGTCCACAACCGGAAGATATCATTTTCCCGAGCTAACCATGCCTACAG

TGTTGGTAATCTTGCACATGTCCATTTCGCCTCGAATATCTTCTCCCTTCCGCTGAAAACTGAAAAGAATCCTAGAGGTATATACACCGAGCATGAAATGTTCATGGTTATGTGTGTCGT
TTTCACATGTATCTTCTTTGATCTTGATCCCGCAAAGTCTTTCCCTCTCCGGCAAGCAGCCCGAGTAGTTGCGCAACAATTAGGGAAAATTGTCGAAGGCTATGTCAAGAGTGTGAAAGC
TACTAGCATAATTTCCGGAATTGTGGATCGGTTCCGGAAGAATGAGACTGCACTGAAGGACTACGGGATTCACATGATTCGAAGGTTGCTAGCAAGTGGCCAGAGTGTATCTGAGGTAAC
TTGGTCCCAAGTTATGCCAACTGCTGGAGCAATGGTTCCGAACCAGGCACAAGTG
GTAAGTGTCTACAGCTGCCCAGCTTTCATGCCCAGATCTCAAAATAAAAGCTCACCTTTTCTATC
TTTGGGTTACCTAGTTCACTCAAATAATAGACTACTACCTTTCTGAAGAAGGGCGCATCCACCTTCCGGAAATTCAGCGCCTTGCTCATCAAGACACCCCGGAATCTGATGACAAGCTCC
TTCACTACTGCATGGAGGCCATCCGTTTAAATGGCACGTTCGGCTCATATCGAGAAGCCACAACTGCGATGGAAATTGATGACGATGGTCGACATGTCTCAATAAAGCCGGGCGATAAAG
TTTTCGTGAGCTTCGTTTCGGCGAACCGGGACCCAGATATTTTCCCAAATCCAAATGAAGTTCGCCTTGACAGACCGTTAGACTCCTACATTCACTACGGTGAAGGGCCCCATACTTGTT
TGGGTAGAGATGCAAACATGGTGGCTCTCACCTCCATGCTTCGTGTGATCGGAAAACTGAAGAACTTGCGTCGAGCGCCAGGCCCTCAAGGGGAACTAAAGAAGGTCCCTAGACCAGGTG
GATTCTACATTTACATGCGTGAGGATCATGGCAGTTATTTTGTATTCCCGATGA
GTAAGTTTCCTATATTGAGTGAACGGCATGTATGTTTGCGCTAACGAATTACAGCCTTCAAAGTGC
ACTTTGATGGAGAGCTACCTGAGCCACACAGCAGGCCAGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCACTACCAATGGTCATTCAAATGGCATCGGCCATACGAACGGGACGGCAGCTGGTACCAAGGCCTCCCGGAATGGCATTGACAAAGTCAATAGTCGCAAGAGTGCTGTCAAGCGC
CCACAAGTCGAGAGTACATTCAAACAATATGCGCAATTGATTCACGCCGCCAGGCGCCCGCTCCCAAAGCAATCCGGTGACGGAACTTATTTGACAGGACCCAAGGCAAAAACTTCTCTT
CTCCAGGACCTGAGGTCGATGGGCCCCAAAGGATGGGGAACTCTGATAGCTGTGCTGAAAAATAAGAGATCCGGTGATCTCACTGATGACAAGACCTACATCATGGAGCGCATAATCCAC
CTTGTCGCGGGGTTACCGCCAGAGTCAAACATGAGGACCAAGTTGACCAACTCGTTCGTCACCGAGCTTTGGAATACCCTTCCTCATCCATCAGTATCTGCATTCGGAGACGAATACATG
TACAGATCTGCAGACGGATCTAATAACAATCCCCTGTTTCCAAAACTTGGCGCTGCAAACACTCCATATGCTCGCTCCATCATCCCATCGACGATTCAACTCGGTGCTCTCCCTGATCCA
GGCCTGATTTTTGACAGCATCTTTGCTCGGGAAGAATTCAAACCTCACCCTAACGGTGTTTCCAGCATGTTCTTCGCCTGGGCTTCCCTGATCATTCATG
ATTTATTCCAAACCGACCAT
CGAAACCCAAATATCTCTCAGACTTCTTCTTATCTCGATCTTTCAACCCTGTATGGTGACAACCAAGAGGACCAAAACCAGGTGAGGACCTTCAAGGATGGGAAATTAAAACCGGATTGT
TTCTCTGAACCAAGGCTTCTTGCTCTGCCCCCGGTCTGCAGTGTTATTCTAGTTATGCTTAATCG
ATTCCACAATTATGTCGCTGAGCAACTCGCGCATATCAACGAAGGTGGGCGGTTT
AGCAAGCCGAGAACTGGTCTATCGCCTGAGGAATCCACCAAAGCATGGGCCAAATATGACAACGATCTTTTCCAGACAGCCCGACT
GGTTACCTGCGGCCTCTACATAAACATTACATTG
TACGATTACGTGCGTACAATCATTAATCTAACACGCAGTAACACTACTTGGTGCTTG
GATCCACGAGTGAACATGCGTGACAACGCCACCCCAGAGGCCGCAGCGAGTGGAACAGGCAAT
CAATGCTCGGTTGAGTTCAATCTGGCCTACCGATGGCATTCTTGCATCGGACAACAAGACGAAAGGTGGACAGAAGGGATATACCAGGAATTGTTTGGAAAACCTGCTGGAGAAGTCTCG
ATGCCTGATCTCCTGATGGGGATGAAGAAATGGCAGACCGAATTACCCAAAGACCCGTCTCACAGATCCTTTGCAGGTTTGAAACGTGGCTCTGATGGCCGATTCAACGATGACGACCTT
GTGAAGATTATGACCGAAAGCACTGAAGAAATTGCCG
GTTCTTTCGGTCCGCGCAATGTTCCAAAAGCACTACGAGCGGTTGAAATTCTCGGCATTCAACAGGCACGTAAGTGGGGATGT
GGCTCCCTCAATGAATTCCGGAAATTCTTCGGGCTTAAGGAGTACACGACCTTCGAAGAAATTAATTCGGATCCTTACATTGCGGATCAACTTCGTCATTTATATGAACACCCCGATCAC
GTTGAACTATACCCTGGTATCGTTGCCGAGGAGCCTAAAATTCCAATGGTCCCTGGTGCAGGAATTTGCCCCACGTATACGCTGTCTCGAGCCATTCTCTCGGACGCGGTTGCGTTGGTT
CGAGGGGACAGGTTCTATACC
ACCGATTACCATCCCAAGAGTCTCACCAACTGGGGCTATTCTGAAACACACTATGATCTGAACATCAATCAAGGCTGTGTATTTTATAAACTCATTCTC
AGATCCTTCCCTAACCACTTTAAGCCAGATTCAATCTATGCCCATTATCCAATGACAATCCCCAGCGAGAACAAGAAAATATTTGCAGGATTGGGCAGAGAATCCCATTTCTCATGGGAA
AAGCCGGCCTTCATTCCCCCCCGTGTCAACTTGACATCATATCTTGGGGCTAAGACCATTCTAGATAATGCGAAAGATTTTCGAGTAACGTGGGGTGAAGCCACTGGCTTCTTATTCGGT
ACAGGAGGGTTAAACTTCATGCTTTCTGGAGATTCTCCCAAACATGCGAAGCAAAGACAACTGATGGGTAAAGCGCTTTACCATGAAGAATGGAAGAAACAGGTGAAGCAATTTTATGAG
GATATCACTATTAAGCTCCTAAGGCAGAAATCCTACAAGGTTGCAGGAGTGAACCAGGTTGATATCACCAGAGA
TGTTGGTAATCTTGCACATGTCCATTTCGCCTCGAATATCTTCTCC
CTTCCGCTGAAAACTGAAAAGAATCCTAGAGGTATATACACCGAGCATGAAATGTTCATGGTTATGTGTGTCGTTTTCACATGTATCTTCTTTGATCTTGATCCCGCAAAGTCTTTCCCT
CTCCGGCAAGCAGCCCGAGTAGTTGCGCAACAATTAGGGAAAATTGTCGAAGGCTATGTCAAGAGTGTGAAAGCTACTAGCATAATTTCCGGAATTGTGGATCGGTTCCGGAAGAATGAG
ACTGCACTGAAGGACTACGGGATTCACATGATTCGAAGGTTGCTAGCAAGTGGCCAGAGTGTATCTGAGGTAACTTGGTCCCAAGTTATGCCAACTGCTGGAGCAATGGTTCCGAACCAG
GCACAAGTG
TTCACTCAAATAATAGACTACTACCTTTCTGAAGAAGGGCGCATCCACCTTCCGGAAATTCAGCGCCTTGCTCATCAAGACACCCCGGAATCTGATGACAAGCTCCTTCAC
TACTGCATGGAGGCCATCCGTTTAAATGGCACGTTCGGCTCATATCGAGAAGCCACAACTGCGATGGAAATTGATGACGATGGTCGACATGTCTCAATAAAGCCGGGCGATAAAGTTTTC
GTGAGCTTCGTTTCGGCGAACCGGGACCCAGATATTTTCCCAAATCCAAATGAAGTTCGCCTTGACAGACCGTTAGACTCCTACATTCACTACGGTGAAGGGCCCCATACTTGTTTGGGT
AGAGATGCAAACATGGTGGCTCTCACCTCCATGCTTCGTGTGATCGGAAAACTGAAGAACTTGCGTCGAGCGCCAGGCCCTCAAGGGGAACTAAAGAAGGTCCCTAGACCAGGTGGATTC
TACATTTACATGCGTGAGGATCATGGCAGTTATTTTGTATTCCCGATGA
CCTTCAAAGTGCACTTTGATGGAGAGCTACCTGAGCCACACAGCAGGCCAGCTTAA

Retrieve as FASTA