Entry information : OsPrx66
Entry ID 1076
Creation 2009-01-12 (Cyril Jourda)
Last sequence changes 2009-01-12 (Cyril Jourda)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: OsPrx66
Name OsPrx66
Class Class III peroxidase    [Orthogroup: Prx064]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Mixed tissues
Roots
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx66
start..stop
S start..stop
OsiPrx66 618 0 1..347 1..344
TaPrx99-1A 473 2e-169 42..349 31..339
TaPrx99-1B 473 5e-169 42..349 31..339
TaPrx99-1D 469 1e-167 42..349 31..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1967471..1967695 225 N° 2 1968571..1969395 825  
join(1967471..1967695,1968571..1969395)


exon

Literature and cross-references OsPrx66
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q6AVZ7   A3AZP2 [Sequencing error]   Q5U1M7 [Sequencing error]
DNA ref. GenBank:   NC_008398.1 (1967471..1969392)
Cluster/Prediction ref. UniGene:   Os.11551
Protein sequence: OsPrx66
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (319)
PWM (Da):   %s   36439.41 (33559.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.62 (5.20) Peptide Signal:   %s   cut: 31 range:31-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVMVKLNAAVAAAAVVLSLLVVVAVHPAAADAGGDWYGKKSIEETVRKEVEKAIKHNPGVGAALVRLVFHDCWVNGCDGSVLLDKTPYSSSTEKAAANNIGLDGFDVIDAIKSKLGAAVSCADIVVLAGRDASAILSGGRITYDVGTGRKDGVVSSAAAADAVLPESTFDFAQLKDNFASKGLTQGELVILSGAHSIGVAHLSSFHDRLAAATATPIDATYASALAADVERQKGVQRTDNPAEKNNIRDMGAAFQSAAGYDAAGVDTAAVGALDNSYYHNNLQNRVLFKSDWVLRTDGDAAADLAEYRDNATKWDVDFAAAMAKLSKLPAEGTHFEIRKTCRCTNQNYY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, intron 1) and 65 ESTs. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGATGGTGAAGCTTAACGCGGCGGTGGCCGCCGCCGCCGTTGTGCTGTCTCTGTTGGTGGTGGTCGCCGTGCATCCGGCGGCGGCCGACGCCGGCGGCGATTGGTACGGCAAGAAG
AGCATCGAGGAGACGGTGAGGAAGGAGGTGGAGAAGGCCATCAAGCACAATCCCGGCGTGGGTGCCGCCCTTGTCCGTTTGGTGTTCCATGACTGCTGGGTCAAC
GTAAGTATACTAACC
ACCATTTACTTTTTTTTTTCCGAGTACATGAATGACATACAGACACATACACATAGATCAGGATCCTCTGCAGTCGAAGTCACGTGTCTCTGTCACTGGCATGTGGATCCAATGATCCCT
GGACCCACATGTCAGTGACAAATATACCGTGTATTTTGATTGAAGAGGATCTCAATCCCACACGTAATATGTTACACATATTACATTTGCACGTACATATGTGCTTTAAATATATTGTCT
TTAATTAACACACTCTCAAAAAGATTTGGATCTGCTAAATGCATAAGTAAACCTGAAGTCCAATATGTATGCAGCTTAGCTTGCAATATAATGCAAATTTCGGTGGAGCTAGATAGGCCT
TATGGCATTTTTAGTTTGGCTTTTTTTTCTTTTGAATTGGGGATCATGTAAGAGAACTTGTCATGCTTGTCTGCATTAGCTTTTTTTTTTTTTTTGGGGGGGGGGGGTCTAAGTTGATAG
TAAGTAGTAATAACTTTTCTTTTTTTTTTTCACCTGAAAATGATAATTAGATACCTTTTAAATTGTTGGATGATGTTGATGTGGTGCTTGAAAAGTGACTTGTAATGAGTTTGGAGAAAT
AACCACATGCATGAACAATACTATAACATGAATGGATATATAATAACAAAAAAAAAGCAGGGCTGTGATACCTTTTTAAATTGTGAGATGATGTTGATATGGTGTTTCAAAAGTGATTCA
CTTACTGAGTTAATTTGGGCAAATAGCTAGCTTGATCTTAAAATATAACAATTTTTAACTATAAATTTGATTTGAATACATTTTTAAATTGTTAAGATGGAGCGCATAACTAATAAAGAA
TTTTTTCTTGAAAAATGCAGGGTTGTGATGGATCGGTGCTCTTGGACAAGACGCCGTACAGCAGCAGCACGGAGAAGGCGGCGGCGAACAACATCGGCCTGGACGGCTTCGACGTCATCG
ACGCCATCAAATCCAAGCTGGGCGCCGCCGTCTCCTGCGCCGACATCGTGGTGCTCGCCGGCCGCGACGCCTCCGCCATCCTCAGCGGCGGCAGGATCACCTACGACGTCGGCACGGGCC
GCAAGGACGGCGTCGTCTCCTCCGCCGCCGCCGCCGACGCCGTCCTCCCGGAGTCCACCTTCGACTTCGCCCAGCTCAAGGACAACTTCGCCAGCAAGGGGCTCACCCAGGGGGAGCTCG
TCATCCTCTCCGGCGCCCACTCCATCGGCGTCGCCCACCTCTCCTCCTTCCACGACCGCCTCGCCGCCGCCACCGCCACGCCCATAGACGCCACGTACGCGTCGGCGCTCGCCGCCGACG
TCGAACGGCAGAAGGGTGTCCAGCGCACGGACAACCCGGCGGAGAAGAACAACATCCGCGACATGGGCGCGGCGTTCCAGAGCGCCGCCGGGTACGACGCCGCCGGCGTGGACACGGCGG
CGGTGGGGGCGCTGGACAACAGCTACTACCACAACAACCTGCAGAACCGGGTGCTGTTCAAGTCGGACTGGGTGCTGCGCACCGACGGCGACGCCGCCGCCGACCTCGCCGAGTACAGGG
ACAACGCCACCAAGTGGGACGTGGACTTCGCCGCCGCCATGGCCAAGCTCAGCAAGCTCCCCGCCGAGGGCACCCACTTCGAGATCAGGAAGACTTGCAGATGCACCAACCAGAACTACT
ACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGATGGTGAAGCTTAACGCGGCGGTGGCCGCCGCCGCCGTTGTGCTGTCTCTGTTGGTGGTGGTCGCCGTGCATCCGGCGGCGGCCGACGCCGGCGGCGATTGGTACGGCAAGAAG
AGCATCGAGGAGACGGTGAGGAAGGAGGTGGAGAAGGCCATCAAGCACAATCCCGGCGTGGGTGCCGCCCTTGTCCGTTTGGTGTTCCATGACTGCTGGGTCAAC
GGTTGTGATGGATCG
GTGCTCTTGGACAAGACGCCGTACAGCAGCAGCACGGAGAAGGCGGCGGCGAACAACATCGGCCTGGACGGCTTCGACGTCATCGACGCCATCAAATCCAAGCTGGGCGCCGCCGTCTCC
TGCGCCGACATCGTGGTGCTCGCCGGCCGCGACGCCTCCGCCATCCTCAGCGGCGGCAGGATCACCTACGACGTCGGCACGGGCCGCAAGGACGGCGTCGTCTCCTCCGCCGCCGCCGCC
GACGCCGTCCTCCCGGAGTCCACCTTCGACTTCGCCCAGCTCAAGGACAACTTCGCCAGCAAGGGGCTCACCCAGGGGGAGCTCGTCATCCTCTCCGGCGCCCACTCCATCGGCGTCGCC
CACCTCTCCTCCTTCCACGACCGCCTCGCCGCCGCCACCGCCACGCCCATAGACGCCACGTACGCGTCGGCGCTCGCCGCCGACGTCGAACGGCAGAAGGGTGTCCAGCGCACGGACAAC
CCGGCGGAGAAGAACAACATCCGCGACATGGGCGCGGCGTTCCAGAGCGCCGCCGGGTACGACGCCGCCGGCGTGGACACGGCGGCGGTGGGGGCGCTGGACAACAGCTACTACCACAAC
AACCTGCAGAACCGGGTGCTGTTCAAGTCGGACTGGGTGCTGCGCACCGACGGCGACGCCGCCGCCGACCTCGCCGAGTACAGGGACAACGCCACCAAGTGGGACGTGGACTTCGCCGCC
GCCATGGCCAAGCTCAGCAAGCTCCCCGCCGAGGGCACCCACTTCGAGATCAGGAAGACTTGCAGATGCACCAACCAGAACTACTACTAG

Retrieve as FASTA