Entry information : ArubCcP01
Entry ID 10761
Creation 2012-03-16 (Christophe Dunand)
Last sequence changes 2012-05-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-16 (Christophe Dunand)
Peroxidase information: ArubCcP01
Name ArubCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP005]
Taxonomy Eukaryota Fungi Ascomycota Saccharomycetes Ascoideaceae Ascoidea
Organism Ascoidea rubescens    [TaxId: 54195 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ArubCcP01
start..stop
S start..stop
SpasCcP02 325 8e-113 3..253 52..299
HburCcP01 320 2e-111 4..252 8..253
DhCcP01 317 8e-108 4..255 171..419
PstiCcP01 303 6e-104 4..255 48..296
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 324254..324375 122 N° 2 323333..323996 664  
complement(join(323333..323996,324254..324375))


exon

Literature and cross-references ArubCcP01
DNA ref. JGI genome:   scaffold_9 (324375..323333)
Cluster/Prediction ref. JGI gene:   76605
Protein sequence: ArubCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   261
PWM (Da):   %s   29444.68  
PI (pH):   %s   5.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKCPDFDDGSYAPNLLRLAWHSSATYDKYTKTGGSNGATMRFPPELTDSANTGLNTARDLLEPVKSKFPWISYADLWILAGLVAIEEMDGPKIPFKPGRTDCGPNDLALIPPNGRLPLGFKDSQHIREIFSRLEMNDQEIVALLGAHGLGRTHAKYSGWDGKWTSNPIKFDNEFYKILLNDNWVFGKVESTGKKQYFNEKNPELMMLPTDLELVKDSSFKKWVEVYANDQDKFFEDFSNAFFKLTELGVERNECGFAPKIR

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Incorrect prediction from JGI (large 5'end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATGTCCAGACTTTGATGATGGTTCTTATGCTCCAAACTTACTAAGATTAGCCTGGCACTCTTCCGCTACCTATGATAAATATACTAAAACTGGAGGCTCTAATGGTGCAACTATG
AG
GTAATATTTCACTTTTACTTGTTTCTTAACTTTTCTTATTTATCACAATTTTTTTTTATATTTTTCTTGTCTTTGTTGTAATATTTTTGTTCTATGTTTTGCTTATCCCAATTATTTG
CTATATTATTTTTTTTATTTTTGCTTTGATAATTTTTTTCAGCTTTTTTTCACTTTTTTTCACTTTTTAACAATTTCTAACATTTTTAATTACTCGAATTTTATTTTCAATTTAATATTG
TTAATTTTATTTGGTTTAGATTTCCACCTGAATTAACAGATTCTGCAAACACTGGTTTAAATACTGCAAGAGACCTTTTAGAACCCGTTAAATCGAAATTTCCTTGGATTTCTTATGCAG
ATTTATGGATATTGGCAGGTTTAGTCGCAATAGAAGAGATGGATGGTCCAAAAATTCCTTTTAAACCTGGCAGAACTGACTGTGGTCCGAATGATTTAGCTTTAATACCTCCAAATGGCA
GATTACCACTAGGGTTTAAAGATTCACAGCACATCAGAGAAATATTTTCAAGATTAGAAATGAATGATCAAGAGATTGTTGCTTTATTAGGTGCTCATGGTTTAGGCAGAACTCATGCCA
AATATTCTGGTTGGGATGGGAAATGGACTTCAAATCCTATCAAATTTGATAATGAGTTTTATAAAATTTTGTTGAATGATAATTGGGTTTTTGGAAAAGTTGAGTCGACTGGTAAAAAGC
AATATTTCAATGAAAAGAACCCAGAATTGATGATGTTGCCAACGGATTTAGAGCTTGTTAAAGATTCAAGCTTTAAAAAATGGGTTGAAGTTTATGCTAATGATCAAGATAAGTTTTTTG
AAGATTTTTCAAATGCATTTTTCAAGTTAACTGAGTTAGGAGTTGAAAGGAATGAGTGCGGTTTTGCTCCCAAAATTAGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATGTCCAGACTTTGATGATGGTTCTTATGCTCCAAACTTACTAAGATTAGCCTGGCACTCTTCCGCTACCTATGATAAATATACTAAAACTGGAGGCTCTAATGGTGCAACTATG
AG
ATTTCCACCTGAATTAACAGATTCTGCAAACACTGGTTTAAATACTGCAAGAGACCTTTTAGAACCCGTTAAATCGAAATTTCCTTGGATTTCTTATGCAGATTTATGGATATTGGCA
GGTTTAGTCGCAATAGAAGAGATGGATGGTCCAAAAATTCCTTTTAAACCTGGCAGAACTGACTGTGGTCCGAATGATTTAGCTTTAATACCTCCAAATGGCAGATTACCACTAGGGTTT
AAAGATTCACAGCACATCAGAGAAATATTTTCAAGATTAGAAATGAATGATCAAGAGATTGTTGCTTTATTAGGTGCTCATGGTTTAGGCAGAACTCATGCCAAATATTCTGGTTGGGAT
GGGAAATGGACTTCAAATCCTATCAAATTTGATAATGAGTTTTATAAAATTTTGTTGAATGATAATTGGGTTTTTGGAAAAGTTGAGTCGACTGGTAAAAAGCAATATTTCAATGAAAAG
AACCCAGAATTGATGATGTTGCCAACGGATTTAGAGCTTGTTAAAGATTCAAGCTTTAAAAAATGGGTTGAAGTTTATGCTAATGATCAAGATAAGTTTTTTGAAGATTTTTCAAATGCA
TTTTTCAAGTTAACTGAGTTAGGAGTTGAAAGGAATGAGTGCGGTTTTGCTCCCAAAATTAGATAA

Retrieve as FASTA