Entry information : ArubGPx04
Entry ID 10766
Creation 2012-03-16 (Christophe Dunand)
Last sequence changes 2012-03-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: ArubGPx04
Name ArubGPx04
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Fungi Ascomycota Saccharomycetes Ascoideaceae Ascoidea
Organism Ascoidea rubescens    [TaxId: 54195 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ArubGPx04
start..stop
S start..stop
ArubGPx02 119 2e-34 18..202 3..174
SkuGPx01 116 1e-33 40..204 14..162
SceGPx02 116 2e-33 40..204 14..162
SpastGPx03 116 2e-33 40..204 14..162
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 604591..604702 112 N° 2 606182..606684 503  
join(604591..604702,606182..606684)


exon

Literature and cross-references ArubGPx04
DNA ref. JGI genome:   scaffold_3 (604591..606684)
Cluster/Prediction ref. JGI gene:   74775 [Incorrect prediction]
Protein sequence: ArubGPx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   204
PWM (Da):   %s   23488.12  
PI (pH):   %s   9.49
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYRPNSPTLFSPENTISTTTSNTFSNTFSSTISNTISNYKGELLHLNYLQNKVVLIINISNIDSLASSNHHFAQLEHLYEKYSHLGFEILAFPTNQFDKETGQELGGRRKQYVSQYEIQHNQLSNEILKKIKYPVMSCCKVNGKNQLELFDWLKSQKKGVIRIRTIKMNFEKFVVDKDGHVVERFSCFTKPSKLENLIQTLLKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 introns). Incorrect prediction from JGI (very long prot wo intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACAGACCAAATTCTCCAACATTGTTTTCACCCGAAAATACTATATCAACTACTACCTCAAATACATTCTCAAACACTTTTTCAAGTACAATTTCAAATACAATTTCAAGTCCTTGC
AAAAATATGAGACAAAATAGCAAAAAAAATCCAGATCTTCTAAAATCTTGGAATAAATCCAATTCAAACAACACAATCTCCTTTTCAAATTTTTCCTTTAAAAAATCAAAAAATGTTTAC
AATAATTCAGGTTCAAAAGACTCTGCCTTGATAACAACAAAATTCTCCTTATTCGATATGGAAAATAATGCTAATCTTAACAAACAAAAAAATAGCAGTCACTCAAACAACTCGATAACC
AGAAAATTGCAAGAACATTTTCAAAGTCCTAAAAATACTCCCAAAAACACCCCTCAGAATAGCCCTCAACAAATCCAACACCAATATAATACTTCAGAATATAACTACAGTAATATTAAT
GGATTCTCAGATCAATACAGCGAGACTTGTACCAGTGATTATAATAGTGAATATAATAGTGACTATTTTTATAGAGATAACGATCAAATCAGCTACCAATATCAATCGCCTTATCAACTA
AATTCCCAAAGATTTTCTCAACTTAAAGATTTTGACTATAATGAATATGATGAATACGATGAATATGATGAATATGATGAAGCCCTAAATTTGAAATCAATCCCTGAATCTCAAAGTGAA
GAAACTAATAGTGATACTTTTATATTTGTGAATGAGGATCAAATTAGCGAGTCGACACAAGATTTAATGAAAAAAGATCAGCCAGTTGGAAATTTAATGGCCAACTCACTTGATAATGAT
AAGGAAGAAGATATTAAAACTGGTAGTTTTATGCAGCCTCATAACTTTTTAACAACTGTTGATTCGTCTGATATGCAATCATTAACTACTGTTATTATAGCACCTTTGCAACCAAAAAAT
TTTGAGAGTTTTCTCTTCTCCAAGAATAACACACAGACTAGTCACGTAACTAATAATAATGAACATAACGATGATAATAACGATATTATTAGCGCGAATTATGAATCTAATATTTCTTCT
TCCATGTCTTCTAATGAAATAATTTTTTCAAGAAACAGCATTTCGAAATCAAGTATGAAACAAGGATCGAGCGATACAATGATATCCTCAGTGAACTCCATTTCGATATCCAATAGAAGT
TCCAATTCTAATTCAAGTAATCAACTGAGTAAGTTGAGCGCATTGAATTCCAAAAGTTCAATTAAAAGGTATATTCCAAGATCTTTGACTGCTTTGTCATATTCGAAATCTTTAAAGTCA
TTAAAATCGTATAATGTGAATAATGTTAATAACTCGACATCGACATTTCATAATTCACGAAAATCGTCAATGTCAAACATTTCTTTTATGAATTCAGAGGTGGAGTTGGTAACTAACGGT
GAAGTTAATAACGATTTAAATTCAATAGTGATGAGTCCGAAATCATCAATGAATAATAAAACTGCATCTCGTTTATCGATAAATAGTTCTATTTCTGTGCCATACAATATGAAAAATAGA
AACAAGTCAATTTATGACTTTGTTGTTCTAGATTATAAAGGGGAACTTTTGCATTTAAACTACCTTCAAAATAAAGTTGTTCTTATTATTAATATTTCAAATATTGATAGTTTGGCATCG
AGTAACCATCATTTTGCACAGCTAGAGCATCTTTATGAAAAATACAGTCATCTTGGATTTGAGATATTAGCATTTCCAACTAATCAATTTGACAAAGAAACTGGACAGGAATTGGGTGGT
AGGCGCAAACAATATGTTAGCCAGTATGAAATCCAGCACAACCAACTCAGCAACGAGATCTTGAAAAAGATCAAGTATCCAGTTATGAGCTGTTGCAAAGTCAATGGCAAGAACCAATTG
GAATTGTTTGACTGGTTAAAGTCTCAAAAGAAGGGAGTAATACGTATCAGAACTATCAAAATGAACTTTGAAAAATTTGTTGTTGATAAAGATGGCCATGTTGTTGAAAGATTCAGCTGT
TTTACCAAACCAAGTAAATTGGAAAATCTCATCCAAACATTACTAAAAAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACAGACCAAATTCTCCAACATTGTTTTCACCCGAAAATACTATATCAACTACTACCTCAAATACATTCTCAAACACTTTTTCAAGTACAATTTCAAATACAATTTCAAATTATAAA
GGGGAACTTTTGCATTTAAACTACCTTCAAAATAAAGTTGTTCTTATTATTAATATTTCAAATATTGATAGTTTGGCATCGAGTAACCATCATTTTGCACAGCTAGAGCATCTTTATGAA
AAATACAGTCATCTTGGATTTGAGATATTAGCATTTCCAACTAATCAATTTGACAAAGAAACTGGACAGGAATTGGGTGGTAGGCGCAAACAATATGTTAGCCAGTATGAAATCCAGCAC
AACCAACTCAGCAACGAGATCTTGAAAAAGATCAAGTATCCAGTTATGAGCTGTTGCAAAGTCAATGGCAAGAACCAATTGGAATTGTTTGACTGGTTAAAGTCTCAAAAGAAGGGAGTA
ATACGTATCAGAACTATCAAAATGAACTTTGAAAAATTTGTTGTTGATAAAGATGGCCATGTTGTTGAAAGATTCAGCTGTTTTACCAAACCAAGTAAATTGGAAAATCTCATCCAAACA
TTACTAAAAAAATAA

Retrieve as FASTA