Entry information : MperAPx-CcP02
Entry ID 10774
Creation 2012-03-19 (Christophe Dunand)
Last sequence changes 2012-03-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-19 (Christophe Dunand)
Peroxidase information: MperAPx-CcP02
Name MperAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Marasmiaceae Moniliophthora
Organism Moniliophthora perniciosa    [TaxId: 153609 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MperAPx-CcP02
start..stop
S start..stop
MfiaAPx-CcP01 539 0 10..489 8..472
GluxAPx-CcP08 519 0 23..499 28..509
MfiaAPx-CcP03 513 7e-180 19..497 16..502
GluxAPx-CcP[P]09 513 8e-180 23..493 28..504
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1840..2034 195 N° 2 1697..1783 87 N° 3 1576..1642 67 N° 4 1215..1524 310
N° 5 1049..1162 114 N° 6 882..996 115 N° 7 391..756 366 N° 8 87..332 246
complement(join(87..332,391..756,882..996,1049..1162,1215..1524,1576..1642,1697. .1783,1840..2034))


exon

Literature and cross-references MperAPx-CcP02
Protein ref. UniProtKB:   E2LTB6
DNA ref. GenBank:   ABRE01015407.1 (2034..87)
Protein sequence: MperAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   499 (480)
PWM (Da):   %s   53542.48 (51529.4)  
PI (pH):   %s   4.6 (4.43) Peptide Signal:   %s   cut: 20 range:20-499
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSHLAKTVFGSIILHGLAARAYHWPDPQVEYADKVLFGDSFLSAIAADCAPRDETTIAAQWVRIAYHDMATHNVDDGTGGLDSSIAYERDRPENIGSGMLASINDFVLFTSPATGLADTIAMGAVIGVAACGGPVVPFRAGRVDATTAGQPGVPEPQQDLASHTESFRRQGFTGSEMIALVACGHTLGGVRREDFPEVIHDTSVNLTTFDSTIQFDNVVVTEYLSGITNNPLVIGPNTTTNSDLRIFSSDKNVTMQSIASPDSFSKTCSSLFERMINTVPKDVKLSEVVEPIEYKLLSSNAQRRVTLFWADRQGSVCGTLGCSVQPESSRRAGFTYLTRMRGITEGTQYTFSAKVNMTSSISKFWFEIDEGDGSGPIVVDNAGSGYVIDQDTVLLDLGRSKRIFTPDFSNPINFVVAVRGGESSQVSVETYEPASSPIDFLPKRETIQLLPDARFPPTAGFTFFSANASGSVTYLNIQGIVGGESFTQGFVDTGNISF

Retrieve as FASTA  
Remarks Cmplete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCACATCTAGCGAAGACAGTGTTTGGCTCCATCATACTACACGGCCTCGCAGCACGAGCGTACCATTGGCCTGATCCTCAGGTTGAATACGCGGACAAGGTTCTCTTTGGAGAC
AGCTTCTTGTCAGCGATAGCTGCAGACTGTGCTCCTCGAGACGAAACCACTATTGCTGCCCAGTGGGTTCGAATC
GTACGTCTCTTCATAAATCAGATCTTGTTACAATTGATATTCAGG
CCTGAGCTCAGGCCTACCATGATATGGCAACGCACAACGTAGATGACGGTACCGGAGGCCTTGATAGTTCGATTGCGTATGAACGGGATCGGCCTGAAGTAGGCCTATCTCTTCTATCCG
GTGACCACCTCTGACCTTAATATATTTGCTAGAACATAGGTTCGGGAATGCTAGCTTCAATCAACGATTTTGTCCTTTTCACGAGTCCCGCTACTGGGCGTAAGTGCGCGTTCGTCTAAT
CGCTTAACGTACTGTACTCACGTCCCACAGTCGCAGATACCATCGCGATGGGTGCCGTGATTGGTGTCGCTGCGTGCGGTGGACCAGTCGTTCCCTTTAGAGCTGGGAGAGTCGATGCAA
CTACAGCTGGCCAGCCTGGGGTTCCCGAGCCTCAACAAGATTTGGCGTCTCATACAGAATCATTCAGACGTCAGGGCTTCACCGGATCCGAAATGATTGCGCTCGTAGCATGTGGGCACA
CTTTGGGCGGCGTCAGACGCGAAGATTTCCCTGAAGTTATCCACGATACCTCAGTCAATCTCACAACATTCGACTCGACCATCCAGTTTGATAATGTTGT
GTGAGTACTTTGCGTTTTCT
TGTGCGCAAGCTATTGTTGATGTCACTGCCAGTGTGACCGAATACCTATCAGGCATCACCAATAATCCTTTGGTTATTGGCCCTAACACGACGACAAACTCAGATCTTCGTATCTTCTCC
AGTGATAAAAATGTCACCATGCAAAG
GTATGGTATACCTTCGAGTATTCCATTCATAGTTCTAACACCCAGCATTCAGTATCGCATCGCCGGATAGCTTCAGCAAGACCTGCAGCAGCCT
GTTCGAGCGTATGATCAACACGGTGCCTAAGGATGTCAAACTGTCCGAAGTCGTGGAGCCCATTGAGTACAAA
GTTGGCGACACCCGATGTTCCCCGATAGCGACGGCACGTTTGCACTG
TCCACCAGTTTAAGGGTGAGTAACGCTCGGTTTACCTCGGTATATAATGTGCCGGTATAATCTTTTGCTATGTCATAGCTACTCTCTTCGAATGCACAGAGGAGAGTTACCCTGTTCTGG
GCTGACCGTCAAGGGTCAGTATGTGGCACCTTGGGATGTTCTGTACAGCCTGAGTCTTCTCGGAGAGCAGGCTTCACATACCTCACCCGTATGCGGGGTATCACCGAAGGAACGCAGTAT
ACTTTTAGCGCCAAGGTTAACATGACGAGCTCCATATCCAAGTTCTGGTTTGAAATCGACGAAGGAGATGGCTCAGGGCCTATCGTCGTGGACAACGCCGGATCAGGCTACGTCATTGAC
CAGGACACAGTTCTTCTCGACCTCGGTCGGTCCAAACGTATATTCACTCCTGATTTCAGCAATCCTATCAATTTCGTCGTAGCG
GTGAGTCCATTTTTTCCTTCTTGGTTCATTTGTACA
CCGATCTAACACGAGAATGAAGGTTCGGGGAGGCGAATCGTCTCAAGTATCAGTTGAGACGTATGAGCCTGCAAGTAGTCCAATCGATTTCTTACCAAAGAGAGAAACGATCCAACTACT
TCCTGACGCCCGTTTCCCTCCTACAGCTGGTTTCACTTTCTTCTCAGCAAACGCCAGTGGTTCTGTTACCTATCTGAATATCCAAGGAATTGTTGGTGGAGAGAGCTTTACCCAAGGTTT
CGTAGACACGGGGAATATTTCGTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCACATCTAGCGAAGACAGTGTTTGGCTCCATCATACTACACGGCCTCGCAGCACGAGCGTACCATTGGCCTGATCCTCAGGTTGAATACGCGGACAAGGTTCTCTTTGGAGAC
AGCTTCTTGTCAGCGATAGCTGCAGACTGTGCTCCTCGAGACGAAACCACTATTGCTGCCCAGTGGGTTCGAATC
GCCTACCATGATATGGCAACGCACAACGTAGATGACGGTACCGGA
GGCCTTGATAGTTCGATTGCGTATGAACGGGATCGGCCTGAA
AACATAGGTTCGGGAATGCTAGCTTCAATCAACGATTTTGTCCTTTTCACGAGTCCCGCTACTGGGCTCGCAGATACC
ATCGCGATGGGTGCCGTGATTGGTGTCGCTGCGTGCGGTGGACCAGTCGTTCCCTTTAGAGCTGGGAGAGTCGATGCAACTACAGCTGGCCAGCCTGGGGTTCCCGAGCCTCAACAAGAT
TTGGCGTCTCATACAGAATCATTCAGACGTCAGGGCTTCACCGGATCCGAAATGATTGCGCTCGTAGCATGTGGGCACACTTTGGGCGGCGTCAGACGCGAAGATTTCCCTGAAGTTATC
CACGATACCTCAGTCAATCTCACAACATTCGACTCGACCATCCAGTTTGATAATGTTGT
TGTGACCGAATACCTATCAGGCATCACCAATAATCCTTTGGTTATTGGCCCTAACACGACG
ACAAACTCAGATCTTCGTATCTTCTCCAGTGATAAAAATGTCACCATGCAAAG
TATCGCATCGCCGGATAGCTTCAGCAAGACCTGCAGCAGCCTGTTCGAGCGTATGATCAACACGGTG
CCTAAGGATGTCAAACTGTCCGAAGTCGTGGAGCCCATTGAGTACAAA
CTACTCTCTTCGAATGCACAGAGGAGAGTTACCCTGTTCTGGGCTGACCGTCAAGGGTCAGTATGTGGCACC
TTGGGATGTTCTGTACAGCCTGAGTCTTCTCGGAGAGCAGGCTTCACATACCTCACCCGTATGCGGGGTATCACCGAAGGAACGCAGTATACTTTTAGCGCCAAGGTTAACATGACGAGC
TCCATATCCAAGTTCTGGTTTGAAATCGACGAAGGAGATGGCTCAGGGCCTATCGTCGTGGACAACGCCGGATCAGGCTACGTCATTGACCAGGACACAGTTCTTCTCGACCTCGGTCGG
TCCAAACGTATATTCACTCCTGATTTCAGCAATCCTATCAATTTCGTCGTAGCG
GTTCGGGGAGGCGAATCGTCTCAAGTATCAGTTGAGACGTATGAGCCTGCAAGTAGTCCAATCGAT
TTCTTACCAAAGAGAGAAACGATCCAACTACTTCCTGACGCCCGTTTCCCTCCTACAGCTGGTTTCACTTTCTTCTCAGCAAACGCCAGTGGTTCTGTTACCTATCTGAATATCCAAGGA
ATTGTTGGTGGAGAGAGCTTTACCCAAGGTTTCGTAGACACGGGGAATATTTCGTTCTAA

Retrieve as FASTA