Entry information : CgaCcP
Entry ID 10779
Creation 2012-03-19 (Christophe Dunand)
Last sequence changes 2012-03-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-19 (Christophe Dunand)
Peroxidase information: CgaCcP
Name CgaCcP
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Cryptococcus gattii (Filobasidiella gattii)    [TaxId: 292817 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgaCcP
start..stop
S start..stop
CgaCcP01_R265 731 0 1..377 1..376
CnCcP01_grubiiH99 713 0 1..377 1..377
CnCcP01_JEC21 710 0 1..377 1..377
TmesCcP01 588 0 1..376 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1166767..1166886 120 N° 2 1166465..1166717 253 N° 3 1166262..1166401 140 N° 4 1165983..1166212 230
N° 5 1165867..1165928 62 N° 6 1165718..1165817 100 N° 7 1165607..1165660 54 N° 8 1165455..1165538 84
N° 9 1165310..1165400 91  
complement(join(1165310..1165400,1165455..1165538,1165607..1165660,1165718..1165 817,1165867..1165928,1165983..1166212,1166262..1166401,1166465..1166717,1166767. .1166886))


exon

Literature and cross-references CgaCcP
Protein ref. UniProtKB:   E6R433
DNA ref. GenBank:   CP000289.1 (1166886..1165310)
Protein sequence: CgaCcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377
PWM (Da):   %s   41839.8  
PI (pH):   %s   9.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFRAPNLLRSTVGRRAGQALNLRSQVIRRRFATEGGPELGKPSPQRSSNTGYLLAGFGIAAAGAAYYFYSSGATARDSTGKADTAVRGAVATVEAKTGLRRGKDDYQKVYNRIAETLEKEGYDDGSLAPVLIRLAWHSSGTYNKEDGSGGSNYATMRFKPESDHSANNGNVAREHMEKIKKEFPWISYGDLWTLGGVCAVQESGGPTIPWRPGRIDGYAAQVTPDGRLPDATQAQDHLRFIFNRMGFNDQEIVALSGAHAMGRCHTRSGFDGPWTFSPVTFSNQYFALLRDEPWQWRKWNGPAQYEDKKTKTLMMLPTDMALVKDKSFKKYVDIYANDEEKFFNDFSKAFSKLIELGVPERQWAGEPWTMTTSE

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo D, 8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAGAGCTCCCAACTTGTTGCGATCCACCGTTGGCCGACGAGCCGGTCAGGCGTTGAACCTGCGTTCTCAGGTTATCCGAAGGCGATTTGCAACTGAGGGTGGACCAGAACTT
GTAAGCAGCTTATTAGCCTTGACTATAGTATTTTACTGAACAAGCGCAGGGTAAACCATCTCCTCAACGATCCTCTAACACCGGTTATCTCCTCGCAGGTTTCGGTATTGCTGCTGCAGG
TGCTGCATACTACTTCTACAGCTCTGGCGCAACCGCGCGTGATTCCACCGGTAAAGCGGACACTGCAGTACGTGGGGCTGTTGCCACGGTTGAGGCCAAGACAGGTCTCAGAAGAGGCAA
GGATGACTATCAGAAAGTCTACAACCGGATTGCCGAAACTCTTGAGAAGGAGGGTTACGACG
GTTAGTTTTCAACCACTCGGGGATGCGGTACCGAACACACGGTGACTGATGAGGAAAT
CTCAGATGGCTCTTTGGCCCCCGTCCTTATTCGCTTGGCTTGGCACTCCTCCGGAACCTATAACAAAGAGGATGGAAGTGGAGGCTCGAACTATGCTACCATGAGGTTCAAGCCAGAGTC
CGACCACAGCGCGAACAATGGCCTT
GTGAGTGTTAATCTAAATAGATAGATGCCTTGGCTCACACATATCAAAGAACGTTGCCAGGGAACATATGGAAAAGATCAAGAAGGAGTTCCCCT
GGATCTCCTACGGGGACTTGTGGACTCTCGGTGGTGTCTGTGCCGTTCAGGAGTCGGGCGGACCTACCATCCCTTGGAGGCCTGGTAGAATTGACGGTTACGCCGCTCAAGTCACTCCCG
ATGGTAGGCTGCCTGATGCCACTCAGGCTCAAGACCATCTGAGGTTTATCTTCAACCGCATGGG
GTGAGTCGCCAAGGCTACCAAAAGAAGAGCCGGAAAACTAACGATATGCAATAGAT
TTAATGACCAAGAAATTGTAGCCCTCAGCGGCGCTCACGCCATGGGAAGATGTCATACTA
GTATGTTTTTTCAGCGATCAACATGGGGAGCGTCTGACGCGATTTTTAGCTCGATCTGGC
TTTGACGGTCCTTGGACTTTCTCCCCTGTCACCTTTTCCAACCAATACTTTGCTCTTCTTCGCGACGAGCCTTGGCAGTGGAGGAAATG
GTGAGTACTCTATCAGTCAACCGGAAACGAT
CAATCGTCTCATCGTAGTATCAACAGGAACGGACCTGCCCAGTACGAGGACAAGAAGACAAAGACTTTGATGATGCTTCCGTAAGTTCTCAAACCAGAATCGCCCGACACGCCGAACATC
TGAGCTCAATGTTGATACATTCATACAGTACGGATATGGCGCTCGTCAAGGACAAGTCCTTCAAGAAATACGTTGACATCTATGCAAACGACGAAGAGAAGTTCTTTAACGAGTGAGTGC
CCGACTGTGATGAAGATTTTGCTGGCAGTCGTTGACCCGAACATAGCTTCTCTAAAGCATTCTCCAAACTCATTGAGCTTGGTGTCCCTGAGAGGCAGTGGGCCGGTGAACCTTGGACTA
TGACAACCAGCGAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAGAGCTCCCAACTTGTTGCGATCCACCGTTGGCCGACGAGCCGGTCAGGCGTTGAACCTGCGTTCTCAGGTTATCCGAAGGCGATTTGCAACTGAGGGTGGACCAGAACTT
GGTAAACCATCTCCTCAACGATCCTCTAACACCGGTTATCTCCTCGCAGGTTTCGGTATTGCTGCTGCAGGTGCTGCATACTACTTCTACAGCTCTGGCGCAACCGCGCGTGATTCCACC
GGTAAAGCGGACACTGCAGTACGTGGGGCTGTTGCCACGGTTGAGGCCAAGACAGGTCTCAGAAGAGGCAAGGATGACTATCAGAAAGTCTACAACCGGATTGCCGAAACTCTTGAGAAG
GAGGGTTACGACG
ATGGCTCTTTGGCCCCCGTCCTTATTCGCTTGGCTTGGCACTCCTCCGGAACCTATAACAAAGAGGATGGAAGTGGAGGCTCGAACTATGCTACCATGAGGTTCAAG
CCAGAGTCCGACCACAGCGCGAACAATGGCCTT
AACGTTGCCAGGGAACATATGGAAAAGATCAAGAAGGAGTTCCCCTGGATCTCCTACGGGGACTTGTGGACTCTCGGTGGTGTCTGT
GCCGTTCAGGAGTCGGGCGGACCTACCATCCCTTGGAGGCCTGGTAGAATTGACGGTTACGCCGCTCAAGTCACTCCCGATGGTAGGCTGCCTGATGCCACTCAGGCTCAAGACCATCTG
AGGTTTATCTTCAACCGCATGGG
ATTTAATGACCAAGAAATTGTAGCCCTCAGCGGCGCTCACGCCATGGGAAGATGTCATACTACTCGATCTGGCTTTGACGGTCCTTGGACTTTCTCC
CCTGTCACCTTTTCCAACCAATACTTTGCTCTTCTTCGCGACGAGCCTTGGCAGTGGAGGAAATG
GAACGGACCTGCCCAGTACGAGGACAAGAAGACAAAGACTTTGATGATGCTTCCT
ACGGATATGGCGCTCGTCAAGGACAAGTCCTTCAAGAAATACGTTGACATCTATGCAAACGACGAAGAGAAGTTCTTTAACGA
CTTCTCTAAAGCATTCTCCAAACTCATTGAGCTTGGT
GTCCCTGAGAGGCAGTGGGCCGGTGAACCTTGGACTATGACAACCAGCGAATAA

Retrieve as FASTA