Entry information : OsPrx69
Entry ID 1079
Creation 2006-06-26 (Filippo Passardi)
Last sequence changes 2006-06-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx69
Name OsPrx69
Class Class III peroxidase    [Orthogroup: Prx152]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx69
start..stop
S start..stop
SiPrx93 517 0 27..332 27..334
SbPrx113 496 1e-178 28..332 31..338
ZmPrx77 496 2e-178 1..332 1..336
BdiPrx78 468 2e-167 8..332 8..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2001512..2001751 240 N° 2 2001861..2002619 759  
join(2001512..2001751,2001861..2002619)


exon

Literature and cross-references OsPrx69
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1M4
DNA ref. GenBank:   NC_008398.1 (2001512..2002616)
Protein sequence: OsPrx69
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332
PWM (Da):   %s   35183.81 Transmb domain:   %s   i13-35o
PI (pH):   %s   9.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAGSRDGGARRRSCSVLVAAAAIFFGYAATAAGLQVGYYNNSCPGAEDLIQTIVHGAVRNDAGNGPGLIRLFFHDCFVRGCDASVLLDADPASNGTVEKMAPPNFPSLRGFGVIDRAKRVVERRCPGVVSCADIVAFAARDASRIMGGIKFAMPAGRLDGRVSSASEALANLPPGSFNLTQLVARFATKNLTADDMVTLSGAHSIGRSHCSSFSSRLYPQIDPAMNATLGVRSRAKCAAAPGRLDRVVQLDFKTPLQLDNQYYQNVLTHEVVFTSDQSLIDRPDTAALVAQYAGSRKLWSQKFAAAMVKMGNLDVLTGPPGEIRQYCNKVN*

Retrieve as FASTA  
Remarks chromosome 5. No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGGTAGCAGAGACGGCGGTGCTCGCCGCCGATCGTGTAGTGTGCTCGTCGCTGCTGCGGCGATCTTCTTTGGTTACGCGGCGACGGCGGCGGGGCTGCAGGTGGGCTACTAC
AACAACTCATGCCCCGGAGCTGAGGACCTGATTCAGACGATCGTCCATGGCGCCGTCCGCAACGACGCCGGCAATGGCCCCGGCCTCATCCGCCTCTTCTTCCACGACTGCTTCGTCAGG
GTCAGTGATACTGATATCGCATTGCGGTTAATTTGGTTGAATTCACTTGGTCGAATTTGGTTGAGCTGATGATCGAGAGGTGTTCGATGCAATGCGAATGTGTACGTAGGGGTGCGACGC
GTCGGTGCTGCTCGACGCCGACCCGGCGAGCAACGGCACGGTGGAGAAGATGGCGCCGCCCAACTTCCCCAGCCTGCGCGGCTTCGGCGTCATCGACCGCGCCAAGCGCGTCGTGGAGCG
GCGCTGCCCGGGCGTGGTCTCCTGCGCCGACATCGTCGCGTTCGCGGCGCGCGACGCGTCGCGCATCATGGGCGGGATCAAGTTTGCCATGCCCGCCGGCCGCCTCGACGGCCGCGTCTC
GAGCGCGTCCGAGGCGCTCGCCAACCTGCCCCCCGGGTCGTTCAACCTCACCCAGCTCGTCGCCCGCTTCGCCACCAAGAACCTCACCGCCGACGACATGGTCACCCTCTCCGGCGCCCA
CTCCATCGGCCGCTCCCACTGCTCCTCCTTCTCCTCCCGCCTCTACCCGCAGATCGACCCCGCCATGAACGCCACGCTCGGCGTCCGCTCGCGCGCCAAGTGCGCCGCGGCGCCGGGGCG
CCTCGACCGCGTCGTGCAGCTCGACTTCAAGACGCCGCTGCAGCTGGACAACCAGTACTACCAGAACGTGCTGACGCACGAGGTGGTGTTCACGTCGGACCAGTCGCTGATCGACCGCCC
CGACACGGCGGCGCTGGTGGCGCAGTACGCCGGCAGCCGGAAGCTGTGGTCGCAGAAGTTCGCCGCCGCCATGGTCAAGATGGGCAACCTCGACGTGCTCACCGGCCCACCCGGCGAGAT
CCGGCAATACTGCAACAAAGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGGTAGCAGAGACGGCGGTGCTCGCCGCCGATCGTGTAGTGTGCTCGTCGCTGCTGCGGCGATCTTCTTTGGTTACGCGGCGACGGCGGCGGGGCTGCAGGTGGGCTACTAC
AACAACTCATGCCCCGGAGCTGAGGACCTGATTCAGACGATCGTCCATGGCGCCGTCCGCAACGACGCCGGCAATGGCCCCGGCCTCATCCGCCTCTTCTTCCACGACTGCTTCGTCAGG
GGGTGCGACGCGTCGGTGCTGCTCGACGCCGACCCGGCGAGCAACGGCACGGTGGAGAAGATGGCGCCGCCCAACTTCCCCAGCCTGCGCGGCTTCGGCGTCATCGACCGCGCCAAGCGC
GTCGTGGAGCGGCGCTGCCCGGGCGTGGTCTCCTGCGCCGACATCGTCGCGTTCGCGGCGCGCGACGCGTCGCGCATCATGGGCGGGATCAAGTTTGCCATGCCCGCCGGCCGCCTCGAC
GGCCGCGTCTCGAGCGCGTCCGAGGCGCTCGCCAACCTGCCCCCCGGGTCGTTCAACCTCACCCAGCTCGTCGCCCGCTTCGCCACCAAGAACCTCACCGCCGACGACATGGTCACCCTC
TCCGGCGCCCACTCCATCGGCCGCTCCCACTGCTCCTCCTTCTCCTCCCGCCTCTACCCGCAGATCGACCCCGCCATGAACGCCACGCTCGGCGTCCGCTCGCGCGCCAAGTGCGCCGCG
GCGCCGGGGCGCCTCGACCGCGTCGTGCAGCTCGACTTCAAGACGCCGCTGCAGCTGGACAACCAGTACTACCAGAACGTGCTGACGCACGAGGTGGTGTTCACGTCGGACCAGTCGCTG
ATCGACCGCCCCGACACGGCGGCGCTGGTGGCGCAGTACGCCGGCAGCCGGAAGCTGTGGTCGCAGAAGTTCGCCGCCGCCATGGTCAAGATGGGCAACCTCGACGTGCTCACCGGCCCA
CCCGGCGAGATCCGGCAATACTGCAACAAAGTGAACTAA

Retrieve as FASTA