Entry information : Ani1CysPrx02
Entry ID 10822
Creation 2012-04-23 (Catherine Mathe (Scipio))
Last sequence changes 2012-04-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-25 (Christophe Dunand)
Peroxidase information: Ani1CysPrx02
Name Ani1CysPrx02
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Emericella
Organism Aspergillus nidulans-Emericella nidulans    [TaxId: 162425 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Ani1CysPrx02
start..stop
S start..stop
Ate1CysPrx 412 7e-148 1..261 1..264
Afum1CysPrx 411 3e-147 1..261 1..267
Nf1CysPrx 408 8e-146 1..261 1..267
Pno1CysPrx01 317 2e-110 1..260 2..254
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1631541..1631706 166 N° 2 1631758..1631939 182 N° 3 1631987..1632424 438  
join(1631541..1631706,1631758..1631939,1631987..1632424)


exon

Literature and cross-references Ani1CysPrx02
DNA ref. JGI genome:   ChrII_A_nidulans_FGSC_A4 (2462857..2463773)
Protein sequence: Ani1CysPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   262
PWM (Da):   %s   29030.12  
PI (pH):   %s   9.13
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFFSRTTFRTLNTLFKATPCSKTPITAPLAQPLARRFIGTLPREQPRLRLGSTAPNFEALTTQGKIDFHQWMDGCWTILFSHPADFTPVCTTELGAFAKLKGEFAKRGVKMIGSANDLGSHGDWIKDINEVTGSDVQFPIIADADRKVAWLYDMIDESELANLAEKGIAFTIRSVFIIDPAKKIRLVMSYPASTGRNTAEVLRVIDSLQTADKKGIATPIDWQVGDDVIVPPSVSTEDAKKKFGEVRELKPYLRYTKY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTCTTCTCTCGCACCACCTTCCGCACCTTGAACACGCTGTTCAAGGCCACTCCTTGCTCCAAGACCCCCATCACCGCACCTCTCGCTCAGCCCCTCGCCCGCCGGTTCATC
GGCACCCTGCCCCGCGAACAACCCCGTCTGCGTCTCGGCTCAACTG
GTCAGATTCTTGCATCCTACTGCATCGATTGCGCCTGCTAATGTCATGCAGCCCCCAATTTCGAGGCTCTTACC
ACTCAAGGCAAGATTGACTTTCACCAATGGATGGACGGTTGCTGGACTATCCTCTTCTCCCACCCTGCCGATTTCACGCCCGTCTGCACAACTGAGCTCGGTGCTTTCGCCAAGCTGAAG
GGCGAATTCGCAAAGCGCGGCGTCAAGATGATCGGATTG
GTATGCACTACAACTTCAAGTCGATGGCGCTATACTAATTCAGGCAGAGCGCAAACGATCTCGGCTCTCACGGTGACTGGA
TCAAAGATATAAACGAGGTTACCGGCAGCGACGTTCAATTCCCCATTATCGCCGACGCGGATCGAAAGGTTGCCTGGCTGTACGATATGATTGACGAGTCGGAATTGGCCAACCTCGCCG
AAAAGGGCATCGCCTTCACCATCCGCTCCGTCTTCATTATCGACCCCGCCAAGAAGATCCGTCTTGTCATGAGCTACCCTGCTTCGACTGGACGTAACACAGCCGAGGTCCTCCGTGTTA
TTGACTCTCTCCAGACTGCTGACAAGAAGGGCATCGCGACCCCGATCGACTGGCAGGTTGGTGACGATGTTATCGTCCCTCCTTCCGTGTCTACGGAGGATGCAAAGAAGAAGTTCGGCG
AGGTCCGCGAGCTGAAGCCTTACCTCCGTTACACCAAGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTCTTCTCTCGCACCACCTTCCGCACCTTGAACACGCTGTTCAAGGCCACTCCTTGCTCCAAGACCCCCATCACCGCACCTCTCGCTCAGCCCCTCGCCCGCCGGTTCATC
GGCACCCTGCCCCGCGAACAACCCCGTCTGCGTCTCGGCTCAACTG
CCCCCAATTTCGAGGCTCTTACCACTCAAGGCAAGATTGACTTTCACCAATGGATGGACGGTTGCTGGACTATC
CTCTTCTCCCACCCTGCCGATTTCACGCCCGTCTGCACAACTGAGCTCGGTGCTTTCGCCAAGCTGAAGGGCGAATTCGCAAAGCGCGGCGTCAAGATGATCGGATTG
AGCGCAAACGAT
CTCGGCTCTCACGGTGACTGGATCAAAGATATAAACGAGGTTACCGGCAGCGACGTTCAATTCCCCATTATCGCCGACGCGGATCGAAAGGTTGCCTGGCTGTACGATATGATTGACGAG
TCGGAATTGGCCAACCTCGCCGAAAAGGGCATCGCCTTCACCATCCGCTCCGTCTTCATTATCGACCCCGCCAAGAAGATCCGTCTTGTCATGAGCTACCCTGCTTCGACTGGACGTAAC
ACAGCCGAGGTCCTCCGTGTTATTGACTCTCTCCAGACTGCTGACAAGAAGGGCATCGCGACCCCGATCGACTGGCAGGTTGGTGACGATGTTATCGTCCCTCCTTCCGTGTCTACGGAG
GATGCAAAGAAGAAGTTCGGCGAGGTCCGCGAGCTGAAGCCTTACCTCCGTTACACCAAGTACTAG

Retrieve as FASTA