Entry information : AnKat05
Entry ID 10823
Creation 2012-04-23 (Catherine Mathe (Scipio))
Last sequence changes 2012-04-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnKat05
Name AnKat05
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnKat05
start..stop
S start..stop
AclKat02 1248 0 9..723 4..720
NfKat01 963 0 14..722 28..745
AclKat01 963 0 14..722 28..745
NhaeKat01 962 0 8..722 14..737
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 202862..203053 192 N° 2 202376..202801 426 N° 3 200767..202320 1554  
complement(join(200767..202320,202376..202801,202862..203053))


exon

Literature and cross-references AnKat05
DNA ref. JGI genome:   chr_1_2 (203053..200767)
Protein sequence: AnKat05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   723
PWM (Da):   %s   81666.02  
PI (pH):   %s   6.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASEQFNMATKHDDLARDTVQLSGVQPMTTDYGIKISDPDHWLRVVDAQHNGPSLLEDPIAREKIMRFDHERIPERVVHARGAGAFGTFKLHQAIPELSSAGVLTDTERETPVFVRFSTVQGSRGSADTVRDVRGFAVKMYTAEGNWDIVGNNIPVFFIQDAIKFPDVIHSVKPEPHNEIPQGQSAHNNFWDFQYMHSETTHMQQWVMSDRAIPRSYRMMQGFGVNTYCLVNAKGQRHFVKFHFTPELGVHSLVWDEALKIAGQDPDFHRKDLMDAIEAGQYPRWKFGIQVIPEEKKDDFEFDIQDATKIWPEELVPIQYIGQLELNRNVDEYFPQTEQVAFCTSHIVPGIDFSDDPLLVGRNFSYFDTQISRLGPNWQELPINRPVCPYMSLVNRDGQMRHRITKGKVNYWPNRFDANPPTSPAHGGFATYPEKQRGVKARALSDKFSEHFNQAQLFYNSLSPIEKLHVSKAFSFELDHCDEEIVYKRLSERLAVVDLQLAKTVAKNVGGNTPTKAPKENDGKTSKGLSQFDYLSDSAQIATRRVAILIADGFDLNSYRDMKSALQKQNAFVFTIGSQRQGVTSESGEKVIPDHHFPGMRSTLFDATFVPGGKHVSVLAKNGIAKHWISESFAHLKPIAGVNEAVDFIRKQINLDAVKYASNGQVKESYGVVTAHGAPAELLQVSSNISRESKGFVDQFIWQISRHRNWQRELDGLVDEIAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGCGAACAGTTCAATATGGCCACCAAACATGATGATCTCGCCCGAGATACAGTTCAGCTGTCCGGCGTTCAACCCATGACCACAGACTATGGAATTAAGATATCGGATCCGGAC
CATTGGCTTCGCGTTGTCGATGCGCAGCATAATGGTCCCTCGCTACTGGAGGATCCGATCGCGAGGGAGAAG
GTATGATACACTTCCTTTCTATAGTAGTCCCCTCTGCTAGAGTATTGA
TCGGTGGTGCAGATTATGCGCTTCGACCACGAACGGATTCCCGAACGAGTCGTGCATGCCCGTGGCGCTGGAGCCTTCGGAACCTTCAAGCTTCATCAGGCTATTCCGGAACTTTCCTCT
GCGGGTGTCTTGACTGACACAGAGCGCGAAACTCCCGTCTTTGTTCGCTTTTCTACTGTTCAGGGTAGTCGTGGGAGTGCGGATACTGTGCGTGATGTTCGTGGCTTCGCGGTGAAGATG
TACACTGCGGAAGGCAACTGGGATATTGTTGGGAATAATATTCCTGTTTTCTTTATTCAGGATGCTATCAAGTTCCCTGATGTTATTCATTCGGTGAAGCCGGAGCCTCATAATGAGATT
CCTCAGGGACAGAGTGCTCATAATAACTTTTGGGATTTCCAATACATGCATTCGGAGACTACTCATATGCAGCAGTGG
GTGAGTTTGCTGTGTTTATTTTATTCCCTGGGTCACTGGCTA
ATTGAGTTGCTAGGTTATGTCGGATCGTGCTATCCCTCGTTCGTACCGTATGATGCAAGGCTTCGGTGTCAATACCTACTGCCTTGTGAATGCCAAGGGACAGCGGCACTTTGTCAAGTT
CCATTTCACCCCGGAGCTCGGTGTTCATTCCCTCGTTTGGGACGAAGCGCTGAAGATTGCAGGTCAAGATCCTGACTTCCATCGGAAGGATCTGATGGATGCCATTGAGGCAGGCCAATA
CCCCAGGTGGAAGTTCGGCATTCAGGTGATTCCAGAAGAGAAGAAGGATGACTTTGAGTTCGATATCCAGGATGCAACCAAGATCTGGCCGGAGGAGCTTGTGCCAATCCAGTACATTGG
ACAATTGGAGCTGAATCGCAACGTTGACGAGTACTTCCCCCAAACCGAGCAAGTGGCTTTCTGCACAAGTCATATTGTGCCCGGTATTGACTTCTCGGACGATCCCCTTCTCGTGGGCCG
CAATTTCTCCTACTTCGATACACAGATCTCTCGCTTGGGCCCTAACTGGCAAGAACTGCCAATTAACCGTCCCGTGTGTCCGTATATGAGTCTGGTCAACCGGGATGGTCAAATGAGACA
CCGCATCACAAAGGGCAAAGTGAACTATTGGCCGAACAGGTTCGATGCGAATCCCCCAACCTCTCCGGCCCATGGAGGATTTGCGACCTACCCTGAAAAGCAGCGGGGTGTGAAAGCGCG
TGCACTGTCAGACAAATTTAGCGAGCATTTCAACCAGGCCCAACTGTTCTACAACTCCCTCAGCCCCATAGAAAAGCTTCACGTCTCCAAGGCATTCTCCTTCGAATTGGATCATTGCGA
CGAGGAGATCGTGTATAAGCGCCTCTCAGAACGACTGGCTGTCGTTGACCTCCAGCTGGCGAAGACGGTTGCGAAGAATGTTGGAGGCAACACGCCGACCAAGGCACCAAAGGAGAACGA
CGGAAAAACGTCGAAGGGCTTGAGCCAATTCGACTACCTTTCTGACAGCGCACAAATTGCTACCCGCCGAGTTGCCATCCTGATCGCGGATGGCTTCGACCTCAACTCATACAGGGACAT
GAAGAGTGCGTTGCAGAAGCAGAATGCATTTGTATTCACCATTGGATCCCAGCGCCAGGGTGTCACCTCCGAATCAGGAGAGAAGGTGATCCCCGACCATCATTTCCCAGGAATGCGTTC
CACGCTCTTTGACGCGACTTTTGTCCCCGGCGGAAAGCACGTTAGTGTGCTGGCGAAGAACGGCATCGCTAAGCACTGGATTTCCGAGTCCTTTGCGCACTTGAAGCCTATTGCTGGTGT
CAACGAAGCGGTGGACTTTATCCGGAAGCAAATCAACCTAGACGCGGTCAAATATGCCTCGAATGGTCAAGTGAAAGAAAGCTACGGAGTGGTGACTGCCCATGGTGCACCCGCGGAGCT
GCTGCAAGTATCGTCCAATATTAGTCGCGAGAGCAAGGGATTCGTCGACCAGTTCATTTGGCAAATTTCGAGGCACAGGAACTGGCAGAGGGAACTAGATGGCTTGGTGGATGAGATCGC
TGCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGCGAACAGTTCAATATGGCCACCAAACATGATGATCTCGCCCGAGATACAGTTCAGCTGTCCGGCGTTCAACCCATGACCACAGACTATGGAATTAAGATATCGGATCCGGAC
CATTGGCTTCGCGTTGTCGATGCGCAGCATAATGGTCCCTCGCTACTGGAGGATCCGATCGCGAGGGAGAAG
ATTATGCGCTTCGACCACGAACGGATTCCCGAACGAGTCGTGCATGCC
CGTGGCGCTGGAGCCTTCGGAACCTTCAAGCTTCATCAGGCTATTCCGGAACTTTCCTCTGCGGGTGTCTTGACTGACACAGAGCGCGAAACTCCCGTCTTTGTTCGCTTTTCTACTGTT
CAGGGTAGTCGTGGGAGTGCGGATACTGTGCGTGATGTTCGTGGCTTCGCGGTGAAGATGTACACTGCGGAAGGCAACTGGGATATTGTTGGGAATAATATTCCTGTTTTCTTTATTCAG
GATGCTATCAAGTTCCCTGATGTTATTCATTCGGTGAAGCCGGAGCCTCATAATGAGATTCCTCAGGGACAGAGTGCTCATAATAACTTTTGGGATTTCCAATACATGCATTCGGAGACT
ACTCATATGCAGCAGTGG
GTTATGTCGGATCGTGCTATCCCTCGTTCGTACCGTATGATGCAAGGCTTCGGTGTCAATACCTACTGCCTTGTGAATGCCAAGGGACAGCGGCACTTTGTC
AAGTTCCATTTCACCCCGGAGCTCGGTGTTCATTCCCTCGTTTGGGACGAAGCGCTGAAGATTGCAGGTCAAGATCCTGACTTCCATCGGAAGGATCTGATGGATGCCATTGAGGCAGGC
CAATACCCCAGGTGGAAGTTCGGCATTCAGGTGATTCCAGAAGAGAAGAAGGATGACTTTGAGTTCGATATCCAGGATGCAACCAAGATCTGGCCGGAGGAGCTTGTGCCAATCCAGTAC
ATTGGACAATTGGAGCTGAATCGCAACGTTGACGAGTACTTCCCCCAAACCGAGCAAGTGGCTTTCTGCACAAGTCATATTGTGCCCGGTATTGACTTCTCGGACGATCCCCTTCTCGTG
GGCCGCAATTTCTCCTACTTCGATACACAGATCTCTCGCTTGGGCCCTAACTGGCAAGAACTGCCAATTAACCGTCCCGTGTGTCCGTATATGAGTCTGGTCAACCGGGATGGTCAAATG
AGACACCGCATCACAAAGGGCAAAGTGAACTATTGGCCGAACAGGTTCGATGCGAATCCCCCAACCTCTCCGGCCCATGGAGGATTTGCGACCTACCCTGAAAAGCAGCGGGGTGTGAAA
GCGCGTGCACTGTCAGACAAATTTAGCGAGCATTTCAACCAGGCCCAACTGTTCTACAACTCCCTCAGCCCCATAGAAAAGCTTCACGTCTCCAAGGCATTCTCCTTCGAATTGGATCAT
TGCGACGAGGAGATCGTGTATAAGCGCCTCTCAGAACGACTGGCTGTCGTTGACCTCCAGCTGGCGAAGACGGTTGCGAAGAATGTTGGAGGCAACACGCCGACCAAGGCACCAAAGGAG
AACGACGGAAAAACGTCGAAGGGCTTGAGCCAATTCGACTACCTTTCTGACAGCGCACAAATTGCTACCCGCCGAGTTGCCATCCTGATCGCGGATGGCTTCGACCTCAACTCATACAGG
GACATGAAGAGTGCGTTGCAGAAGCAGAATGCATTTGTATTCACCATTGGATCCCAGCGCCAGGGTGTCACCTCCGAATCAGGAGAGAAGGTGATCCCCGACCATCATTTCCCAGGAATG
CGTTCCACGCTCTTTGACGCGACTTTTGTCCCCGGCGGAAAGCACGTTAGTGTGCTGGCGAAGAACGGCATCGCTAAGCACTGGATTTCCGAGTCCTTTGCGCACTTGAAGCCTATTGCT
GGTGTCAACGAAGCGGTGGACTTTATCCGGAAGCAAATCAACCTAGACGCGGTCAAATATGCCTCGAATGGTCAAGTGAAAGAAAGCTACGGAGTGGTGACTGCCCATGGTGCACCCGCG
GAGCTGCTGCAAGTATCGTCCAATATTAGTCGCGAGAGCAAGGGATTCGTCGACCAGTTCATTTGGCAAATTTCGAGGCACAGGAACTGGCAGAGGGAACTAGATGGCTTGGTGGATGAG
ATCGCTGCATAG

Retrieve as FASTA