Entry information : OsPrx73
Entry ID 1083
Creation 2005-07-21 (Filippo Passardi)
Last sequence changes 2005-07-21 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx73
Name OsPrx73
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx73
start..stop
S start..stop
ZmPrx33 417 1e-147 2..308 34..338
SbPrx117 416 3e-147 8..308 41..338
GmPrx324 305 1e-103 7..307 26..327
AtrPrx19 303 2e-103 9..307 7..303
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7906723..7906887 165 N° 2 7905455..7906216 762  
complement(join(7905455..7906216,7906723..7906887))


exon

Literature and cross-references OsPrx73
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q75GA4
DNA ref. GenBank:   NC_008398.1 (7906887..7905458)
Protein sequence: OsPrx73
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   308
PWM (Da):   %s   32042.11  
PI (pH):   %s   6.99
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAGAGAGGLSGDYYRRSCPQLELVVDMALAPVFAVDQTSPAALLRLFFHDCQVQGCDGSILLNSDERRNITSELGSDKNFGIRDVSTIGLVKAAVERACPGQVSCADIVVLAARSAVAHAGGPRIRGVPLGRRDATAASAERADAMLPDSFLGIDGALAMFQSKGMTVEETVAILGGHTLGGGHCATVDTARRGRGRSDAAFEAALRLACPAAAPRAVAAAVPVLSDATPSWFDNLYYWNAASGRGIFAVDAEEAADARTAGHVRRFAADGRRFFRAFSSAFVKLAMSGVLTGDEGEIRRRCDVVNH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromosome 5, intron 1). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCGGCGCCGGCGCCGGCGGCCTCTCCGGCGACTACTACCGGCGGTCGTGCCCCCAGCTGGAGCTCGTCGTCGACATGGCCCTCGCGCCGGTGTTTGCTGTCGACCAGACCTCG
CCGGCGGCGCTCCTCCGCCTCTTCTTCCACGACTGCCAAGTTCAG
GTACGTACTGACAATATATTTGTCTCCAATACACACTGTTGATTTTTTTTTAAGATAATGGAATATAATCCTGGC
CTTTACTCAAAGAGGCTACAGCCAATAATTACACTAACTCAACAAAAACTCACACCTGAATAAACAAAAGCACATATGAACTAATAAAAACTCACACAGCATAAAAAGATCATAAAAATT
ATTGAATTCTATTAGTGATCATCAAAATCTACCTACGTAAAATCATAATTATAAAGTCGATCATATGTTCGAGGCATGGTTTACTATCTCAAAATGCATAAACATTTTGAGGAAATTTCA
GGAAAATAAATTGATTTTGAACGAAAACTTTTGTTGAATTTCTTCGCTAAATTCAGTAAAATTTGAATTTTTTTACCAGTAGAACATACTACCAGAACCTGTCGGTAAACCTGAAACTTA
TGAAAATTTAGATCCGAAATTTTCATGAGCTTTCAGAGATTTAAGGTTGGACTAGTGAGTTTTTTTTTCAGGGATGTGACGGGTCCATTCTGCTCAACTCCGACGAGCGGCGGAACATCA
CGTCGGAGCTTGGCTCCGACAAGAACTTCGGCATCCGTGACGTCAGCACCATCGGCCTCGTCAAGGCGGCCGTCGAGCGCGCGTGCCCCGGCCAGGTGTCGTGCGCCGACATCGTCGTCC
TCGCGGCGAGGTCGGCCGTGGCGCACGCCGGCGGGCCGCGCATCCGCGGCGTGCCCCTCGGCCGGAGGGACGCCACGGCGGCGAGCGCGGAGCGCGCCGACGCCATGCTCCCGGACAGCT
TCCTCGGCATCGACGGCGCGCTCGCCATGTTCCAGAGCAAGGGCATGACCGTCGAGGAGACCGTCGCCATCCTCGGCGGCCACACGCTCGGCGGCGGCCACTGCGCAACCGTCGACACGG
CGCGGCGCGGGCGCGGGCGCTCCGACGCCGCGTTCGAGGCGGCGCTCCGGCTGGCGTGCCCCGCCGCCGCGCCGCGGGCGGTGGCGGCGGCCGTGCCCGTCCTCAGCGACGCGACGCCGA
GCTGGTTCGACAACCTCTACTACTGGAATGCGGCGTCCGGGCGCGGCATCTTCGCCGTCGACGCCGAGGAGGCCGCCGACGCGCGCACGGCGGGGCACGTGCGGCGGTTCGCGGCGGACG
GGCGCCGCTTCTTCCGGGCCTTCTCGTCGGCGTTCGTGAAGCTCGCCATGAGCGGGGTGCTCACCGGAGACGAAGGGGAGATCAGGAGGCGCTGCGACGTCGTCAACCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCGGCGCCGGCGCCGGCGGCCTCTCCGGCGACTACTACCGGCGGTCGTGCCCCCAGCTGGAGCTCGTCGTCGACATGGCCCTCGCGCCGGTGTTTGCTGTCGACCAGACCTCG
CCGGCGGCGCTCCTCCGCCTCTTCTTCCACGACTGCCAAGTTCAG
GGATGTGACGGGTCCATTCTGCTCAACTCCGACGAGCGGCGGAACATCACGTCGGAGCTTGGCTCCGACAAGAAC
TTCGGCATCCGTGACGTCAGCACCATCGGCCTCGTCAAGGCGGCCGTCGAGCGCGCGTGCCCCGGCCAGGTGTCGTGCGCCGACATCGTCGTCCTCGCGGCGAGGTCGGCCGTGGCGCAC
GCCGGCGGGCCGCGCATCCGCGGCGTGCCCCTCGGCCGGAGGGACGCCACGGCGGCGAGCGCGGAGCGCGCCGACGCCATGCTCCCGGACAGCTTCCTCGGCATCGACGGCGCGCTCGCC
ATGTTCCAGAGCAAGGGCATGACCGTCGAGGAGACCGTCGCCATCCTCGGCGGCCACACGCTCGGCGGCGGCCACTGCGCAACCGTCGACACGGCGCGGCGCGGGCGCGGGCGCTCCGAC
GCCGCGTTCGAGGCGGCGCTCCGGCTGGCGTGCCCCGCCGCCGCGCCGCGGGCGGTGGCGGCGGCCGTGCCCGTCCTCAGCGACGCGACGCCGAGCTGGTTCGACAACCTCTACTACTGG
AATGCGGCGTCCGGGCGCGGCATCTTCGCCGTCGACGCCGAGGAGGCCGCCGACGCGCGCACGGCGGGGCACGTGCGGCGGTTCGCGGCGGACGGGCGCCGCTTCTTCCGGGCCTTCTCG
TCGGCGTTCGTGAAGCTCGCCATGAGCGGGGTGCTCACCGGAGACGAAGGGGAGATCAGGAGGCGCTGCGACGTCGTCAACCATTGA

Retrieve as FASTA