Entry information : OsPrx74
Entry ID 1084
Creation 2005-07-21 (Filippo Passardi)
Last sequence changes 2005-07-21 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx74
Name OsPrx74
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Pannicles
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx74
start..stop
S start..stop
SiPrx96 563 0 1..326 1..326
SbPrx126 554 0 23..326 23..326
BdiPrx73 545 0 22..326 22..325
TaPrx100 545 0 23..326 23..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24438155..24438361 207 N° 2 24438484..24438672 189 N° 3 24438786..24438948 163 N° 4 24439044..24439465 422
join(24438155..24438361,24438484..24438672,24438786..24438948,24439044..24439465 )


exon

Literature and cross-references OsPrx74
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   P37834
DNA ref. GenBank:   NC_008398.1 (24438155..24439462)
Protein sequence: OsPrx74
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (304)
PWM (Da):   %s   35171.64 (33073.5)  
PI (pH):   %s   7.44 (7.13) Peptide Signal:   %s   cut: 23 range:23-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSRVILALLLAAAAVMASSAQLDEKFYSNSCPSVEAVVRKEMVRALGAAPSLAGPLLRMHFHDCFVRGCDGSVLLDSAGNSTAEKDATPNQTLRGFGFVERVKAAVEKACPGTVSCADVLALMARDAVWLSKGPFWAVPLGRRDGRVSIANETDQLPPPTANFTELTQMFAAKNLDLKDLVVLSAGHTIGTSHCFSFTDRLYNFTGLDNAHDIDPTLELQYMARLRSKCTSLQDNTTLVEMDPGSFKTFDLGYFKNVAKRRGLFHSDGELLTNGFTRAYVQRHAGGGYKDEFFADFAASMVKMGGVEVLTGSQGEIRKKCNVVN

Retrieve as FASTA  
Remarks chromosome 5. 14 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGTCGAGGGTGATCCTAGCGCTGCTGCTCGCGGCGGCGGCGGTGATGGCGTCGTCGGCGCAGCTGGACGAGAAGTTCTACAGCAATTCGTGCCCCAGCGTGGAGGCCGTCGTC
CGGAAGGAGATGGTGCGCGCGCTCGGCGCCGCGCCCAGCCTCGCCGGCCCGCTCCTCAGGATGCACTTCCACGACTGCTTCGTCAGG
GTAAGCTGTGCATGCAGTGTCCATTCTCCATTG
CGTCGCGGCTGCTGGTGTATAGTAGTAGTGTTCGATCAGGTCGCCTGACAACCTCGTCGCCGGCCGGCGTCGACTGTCTGTGCATGCAGGGTTGCGACGGCTCGGTGCTGCTCGACTCGG
CCGGGAACAGCACGGCGGAGAAGGACGCGACGCCGAACCAGACGCTGCGCGGGTTCGGCTTCGTCGAGAGGGTGAAGGCCGCCGTGGAGAAGGCATGCCCGGGCACCGTCTCCTGCGCCG
ACGTGCTCGCGCTCATGGCCAGGGACGCCGTGTGGCTG
GTGAGTAGAGTATAGTACACTGCAATGCACGCATGACACGTGTACTCTGACACAGTTTGCAGAAGCAAAAAGTTCTCACCTC
GACTTGTCGTCGTCGTTGTCTTCTCTTCCAGAGCAAGGGCCCGTTCTGGGCGGTGCCTCTCGGCCGCCGCGACGGCAGGGTGTCCATCGCCAACGAGACCGACCAGCTGCCGCCTCCCAC
CGCCAACTTCACCGAGCTCACCCAGATGTTCGCCGCCAAGAACCTCGACCTCAAGGACCTCGTCGTCCTCTCCG
GTAACCATCACCATTGCCACCACACAAACTCTCTTCACACACGTAC
ACACATCCATCCATGGTGTCTGACACGATCCATTGTCGATGTTGATCAGCTGGGCACACGATCGGGACGTCGCACTGCTTCTCCTTCACTGACAGGCTGTACAACTTCACCGGCCTGGAC
AACGCCCACGACATCGACCCGACGCTGGAGCTGCAGTACATGGCGAGGCTGAGGAGCAAGTGCACGAGCCTCCAAGACAACACGACGCTGGTGGAGATGGACCCGGGGAGCTTCAAGACG
TTCGACCTGGGGTACTTCAAGAACGTGGCCAAGCGGCGGGGGCTCTTCCACTCCGACGGCGAGCTGCTCACCAACGGCTTCACCCGCGCCTACGTGCAGCGCCACGCCGGCGGCGGCTAC
AAGGACGAGTTCTTCGCCGACTTCGCCGCCTCCATGGTCAAGATGGGCGGCGTCGAAGTGCTCACCGGCAGCCAGGGCGAGATCAGGAAGAAGTGCAACGTGGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGTCGAGGGTGATCCTAGCGCTGCTGCTCGCGGCGGCGGCGGTGATGGCGTCGTCGGCGCAGCTGGACGAGAAGTTCTACAGCAATTCGTGCCCCAGCGTGGAGGCCGTCGTC
CGGAAGGAGATGGTGCGCGCGCTCGGCGCCGCGCCCAGCCTCGCCGGCCCGCTCCTCAGGATGCACTTCCACGACTGCTTCGTCAGG
GGTTGCGACGGCTCGGTGCTGCTCGACTCGGCC
GGGAACAGCACGGCGGAGAAGGACGCGACGCCGAACCAGACGCTGCGCGGGTTCGGCTTCGTCGAGAGGGTGAAGGCCGCCGTGGAGAAGGCATGCCCGGGCACCGTCTCCTGCGCCGAC
GTGCTCGCGCTCATGGCCAGGGACGCCGTGTGGCTG
AGCAAGGGCCCGTTCTGGGCGGTGCCTCTCGGCCGCCGCGACGGCAGGGTGTCCATCGCCAACGAGACCGACCAGCTGCCGCCT
CCCACCGCCAACTTCACCGAGCTCACCCAGATGTTCGCCGCCAAGAACCTCGACCTCAAGGACCTCGTCGTCCTCTCCG
CTGGGCACACGATCGGGACGTCGCACTGCTTCTCCTTCACT
GACAGGCTGTACAACTTCACCGGCCTGGACAACGCCCACGACATCGACCCGACGCTGGAGCTGCAGTACATGGCGAGGCTGAGGAGCAAGTGCACGAGCCTCCAAGACAACACGACGCTG
GTGGAGATGGACCCGGGGAGCTTCAAGACGTTCGACCTGGGGTACTTCAAGAACGTGGCCAAGCGGCGGGGGCTCTTCCACTCCGACGGCGAGCTGCTCACCAACGGCTTCACCCGCGCC
TACGTGCAGCGCCACGCCGGCGGCGGCTACAAGGACGAGTTCTTCGCCGACTTCGCCGCCTCCATGGTCAAGATGGGCGGCGTCGAAGTGCTCACCGGCAGCCAGGGCGAGATCAGGAAG
AAGTGCAACGTGGTTAACTAA

Retrieve as FASTA