Entry information : EglPrx18
Entry ID 10841
Creation 2012-05-02 (Qiang Li)
Last sequence changes 2013-02-07 (Qiang Li)
Sequence status partial
Reviewer Christophe Dunand
Last annotation changes 2016-04-07 (Christophe Dunand)
Peroxidase information: EglPrx18
Name EglPrx18
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx18
start..stop
S start..stop
EcamPrx18 166 7e-54 1..115 1..214
EgrPrx18 130 1e-38 1..85 1..92
EgrPrx18 89 9e-23 66..115 230..319
EgrPrx20 128 7e-38 1..85 1..92
EgrPrx20 89 9e-23 66..115 230..319
EcamPrx20 127 3e-37 1..85 1..92
EcamPrx20 87 4e-22 66..115 230..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..195 195 N° 2 2001..2123 123 N° 3 2244..2273 30  
join(1..195,2001..2123,2244..2273)


exon

Literature and cross-references EglPrx18
Protein sequence: EglPrx18
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   115 (90)
PWM (Da):   %s   12327.17 (9719.9)  
PI (pH):   %s   9.47 (10.22) Peptide Signal:   %s   cut: 26 range:26-115
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACESSSTRPAFLLLLCFLHGTASAQLSSTFYSTSCPSALSTIKSSVSSAVKNEARMGASLLRLDGGDSKLFPFDTTSPTSFDNAFFKNLQTHKVFLHSDQQLFSxIRKNCRKVN

Retrieve as FASTA  
Remarks Partial sequence from NGS. PS are missing due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCCACCAGACCAGCCTTCTTATTGTTGCTGTGTTTCCTCCATGGAACAGCCTCTGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATCAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTGAC
TTCCANNNNNNNNNNNTCAATGCAAGTCCCTCTGCTCTGAGTCTC
TCCTCTCTTTCCGATTGATTACTACCATTGTTTCTCTCCTTCATTCAAGCTGAATGCAAGNNNNNNNNNNNNNNNNNNNNNTGTGCCTACGCATGTGAAGCGTTCCATCCAACCACATAG
TCAAAAGAATCATTAGATTCGCTTCTACGCAAGTTACGTACTCTCTTTTTCACTAATTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTTTGCATGGCCTCATTAGTTTGCTTTCACACAAATTCAAAGTGTCAATCTAAATTAACTAATCGATTTAGATTAGTATGTTCATAATGGGGGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGAGGCGACAGCAAACTCTTTCCTTTTGACACCACAAGCC
CGACGTCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAATTGTTCAGTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGATTAGAAAGAATTGCAGGAAAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCCACCAGACCAGCCTTCTTATTGTTGCTGTGTTTCCTCCATGGAACAGCCTCTGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATCAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTGAC
GGAGGCGACAGCAAACTCTTTCCTTTTGACACCACAAGCCCGACG
TCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAATTGTTCAGTGNN
ATTAGAAAGAATTGCAGGAAAGTCAACTGA

Retrieve as FASTA