Entry information : EglPrx20
Entry ID 10842
Creation 2012-05-02 (Qiang Li)
Last sequence changes 2016-03-17 (Christophe Dunand)
Sequence status partial
Reviewer Achraf Jemmat
Last annotation changes 2016-03-17 (Achraf Jemmat)
Peroxidase information: EglPrx20
Name EglPrx20
Class Class III peroxidase     [Orthogroup: Prx010]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx20
start..stop
S start..stop
EgrPrx20 570 0 1..280 40..319
EguPrx17 552 0 1..280 40..319
EgrPrx18 551 0 1..280 40..319
EcamPrx20 545 0 1..280 40..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..99 99 N° 2 1217..1408 192 N° 3 1529..1694 166 N° 4 1817..2202 386
join(1..99,1217..1408,1529..1694,1817..2202)


exon

Literature and cross-references EglPrx20
Protein sequence: EglPrx20
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   280
PWM (Da):   %s   29920.9  
PI (pH):   %s   8.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
LSTIKSSVSSAVKNEARMGASLLRLHFHDCFVNGCDASILLDDITNFTGEKNAGPNANSMRGFEVIDAIKSELESKCPSIVSCADILAVVARDSIVALGGPSWTVNLGRRDSTTASQSAANISIPPPTLNLSGLISTFSNKGFTAKEMVALLGSHTIGQARCLTFREHLYNENNIDATFATSLKANCPSSGGDSKLFPFDTTSPTSFDNAFFKNLQTHKVFLHSDQQLFSGGSTDVHVNAYSSNLSTFRTDFANAMVKMGNLSPLIGSSGQIRKNCRKVN*

Retrieve as FASTA  
Remarks Partial sequence from NGS. 5' and PS are missing due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCTCCACCATTAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAATGCAAGTCCCTCTGCTCTGAGT
CTCTCCTCTCTTTCCGATTGATTACTACCATTGTTTCTCTCCTTCATTCAAGCTGAATGCAAGCGAGCATGCATGATGCATCTTTGTGCCTACGCATGTGAAGCGTTCCATCCAACCACA
TAGTCAAAAGAATCATTAGATTCGCTTCTACGCAAGTTACTTACTCTCTTTTTCACTAACCAAACAGTAGGTAGGAGGTTGACATATTGAATTAGTTGAGATTTTTGGTGCTTTGTTGTG
TCATGCATTTTTGTGAGTTTATTATACCAATAATCAATTCTGTTTATTAGAGCACAATAATTTTTTTGGTAATTCGAAAAAACTTCATGATTATTTTTAGCATACATTGCCGGTGTAAAA
ATATTTTTCACAAACAATCTTATCCACCCTTAATTTGGCGGTTAGTGAGAGATTTGGTAATTAGAATCCTCAAATTACGAATGGCCAAGAATGATTATGTAAAATTTTCTTTACATTGAT
GGTCTATGCTCTAATTTTCACCGGAAAAAACTATGCAGGAGAGCGTACTTTATGCTAACTATGCTGTTGATCAGATAAATGGGTATATAAATAACATTGGAGCTGGCAAAAAGAGAGAGA
TGGCCATTGCTTTTTATATCGGCGGTTGACTTTACTCGGTTATCACATTTGGCTAACCAATCAGTCCTTCTCAATAGATTTTGATCATATTTTGATCACCTCGCTGTGGTAGCCATACAT
TTCTACATAAAAAGTGATATGGATGGTAAAGTATCATTTTTAATGAAATTTGATAACTCAATACTATTCTAAAATCGCACTAGATCTTTGAACAAGCAAATCGTGCCTTTTGCATGGCCT
CATTAGTTTGCTTTCACACAAATTCAAAGTGTCAATCTAAATTAACTAATCGATTTAGATTAGTATGTTCATANNNNNNNNNNNNNNNNNNNNNCTATTTCAGTAAAGATTATAGCACTT
AACTTGTTTTTTTTTTTTTTTGGGTAAGGTATAGCACTTAACTTGTTTGCAACCATTAAATCTAATTAACTCCAATCGGATCAATTTTCTATCTAGAAGGACTGATTAACAACATGTGGC
AAAAAACATGAAATCGGGATGCGACGCGTCAATCTTATTGGACGACATTACGAACTTTACCGGGGAGAAGAACGCCGGCCCGAATGCCAATTCCATGCGGGGATTTGAGGTAATTGACGC
AATCAAGTCCGAATTGGAGAGCAAGTGCCCCAGTATTGTGTCCTGCGCTGATATTTTAGCCGTCGTTGCACGAGACTCCATCGTTGCC
GTAAGTGCACATTTTCTTCTCAATTGTACTTA
TCAATTGTGATGAAAAAAATCACATGTTATGTTCCCCATGCTATATTAATACTAACACGTATCGATTTGTTATTTATTTAATTTTTAGTTAGGTGGCCCTAGTTGGACAGTCAACCTTGG
AAGAAGAGACTCAACCACTGCAAGTCAAAGTGCTGCTAATATTAGCATTCCTCCCCCAACTTTGAACCTTAGCGGCCTAATCTCTACCTTCTCTAACAAAGGCTTCACAGCTAAAGAAAT
GGTGGCACTTTTAG
GTCATTGTTTCTTTCTTCTTCTTTTTTTCTTTTTTTTTTGCAATATTTAATAAAGAATAACAATAATGCTCGATCAATATACTAAAATCAATTTACAAAAATTGTT
CGACCATTGTTAACAGGGTCGCACACTATAGGTCAAGCCCGATGCCTGACTTTCCGGGAGCATCTTTACAATGAGAACAACATCGATGCCACGTTCGCGACATCGCTGAAAGCAAATTGC
CCAAGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGACACCACAAGCCCGACGTCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAA
TTGTTCAGTGGTGGCTCCACGGACGTTCACGTGAATGCTTATAGTAGCAATTTGTCCACTTTTAGGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTTAGCCCACTCATTGGC
TCAAGCGGTCAGATTAGAAAGAATTGCAGGAAAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCTCCACCATTAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAATGGATGCGACGCGTCAATCTTA
TTGGACGACATTACGAACTTTACCGGGGAGAAGAACGCCGGCCCGAATGCCAATTCCATGCGGGGATTTGAGGTAATTGACGCAATCAAGTCCGAATTGGAGAGCAAGTGCCCCAGTATT
GTGTCCTGCGCTGATATTTTAGCCGTCGTTGCACGAGACTCCATCGTTGCC
TTAGGTGGCCCTAGTTGGACAGTCAACCTTGGAAGAAGAGACTCAACCACTGCAAGTCAAAGTGCTGCT
AATATTAGCATTCCTCCCCCAACTTTGAACCTTAGCGGCCTAATCTCTACCTTCTCTAACAAAGGCTTCACAGCTAAAGAAATGGTGGCACTTTTAG
GGTCGCACACTATAGGTCAAGCC
CGATGCCTGACTTTCCGGGAGCATCTTTACAATGAGAACAACATCGATGCCACGTTCGCGACATCGCTGAAAGCAAATTGCCCAAGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGAC
ACCACAAGCCCGACGTCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAATTGTTCAGTGGTGGCTCCACGGACGTTCACGTGAATGCT
TATAGTAGCAATTTGTCCACTTTTAGGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTTAGCCCACTCATTGGCTCAAGCGGTCAGATTAGAAAGAATTGCAGGAAAGTCAAC
TGA

Retrieve as FASTA