Entry information : EglPrx21
Entry ID 10843
Creation 2012-05-02 (Qiang Li)
Last sequence changes 2012-05-02 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-13 (Christophe Dunand)
Peroxidase information: EglPrx21
Name EglPrx21
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx21
start..stop
S start..stop
EgrPrx21 645 0 1..319 1..319
EguPrx21 643 0 1..319 1..319
EcamPrx22 640 0 1..319 1..319
EcamPrx21 639 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..216 216 N° 2 1795..1986 192 N° 3 2109..2274 166 N° 4 2383..2768 386
join(1..216,1795..1986,2109..2274,2383..2768)


exon

Literature and cross-references EglPrx21
Protein sequence: EglPrx21
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (294)
PWM (Da):   %s   33397.42 (30587.0)  
PI (pH):   %s   8.15 (8.21) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARESSSVRSAFLLLLCFLLETASAQLSSTFYSTSCPSALSTIKSGVSSAVKSEARMGASLLRLHFHDCFVNGCDASVLLDDTANFTGEKNAGPNANSLRGFNVIDTIKSQLESACPGIVSCADLLTVAARDSVVALGGPSWTVPLGRRDSTTASQSAANSNIPAFTLSLSGLITAFSNKGFTAKEMVALSGSHTIGQARCTTFRTRLYNENNINATFATSLKANCPSSGGDNNLSPLDTTSPTSFDNAYFKNLQIQKGLLHSDQQLFSGGSTDAQVNAYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKSCGKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCTTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
GCAAGTCCCTCTGCCCGGAGTCTC
TCCTCTCTTTCCGATTGATTGCTACCTTTGTTTCTCTTCNNNNNNNNNNNNNNNNNNNAAGCGTGCATGCAGGATGCATCTTTGTGCTTTTGTGCATGTGAAACGTTCCAACCGACCTCA
TAGTCAAAAAGAATGATTAGATTTCGCTTCTACGCAAGTTACTCTCTTTTTCACTAACCAAACAATAGGTAGGAAGTACACATATTGAATTAATCGAGTCTGACCGACCCTTTTTGTGCC
ATGCATTTTTGTGAGTTTATTATTATTATAATAATATAAAAAGCACGGCCCTTAGAATAAAAGCACTTCTTTTTGGTGATTCAAAGAAAAAANNNNTTCATGAGAAATTCTAGTATACAC
CGCTAGTGTAAAAATCTCATTCCGTAAGTGGTCTTATCTACTAGATATTTTGGTGCTTGGGGAGAGNNNNNNNAATTAGAATCCTCGAATCAAGATGGACAAGAATATTGTTGTGCGTGC
TCTAATTTTTTTTTTTTTCATTTATTATATCGACAATGTAAGCCATGCAGGCGAGCGTATTTTATGCCGAGTATGTTGTGGATAAGACGTGTTTGTGTATGATTAGCTACATGATTTTAA
ATTTGATGAATTAGATCACGCAAAAGTCCTAGTCGTTGGAGATGGCAAAAAGAGAGAGCGACAGCCATGCTTTTATGACGGTGGTTGACTTTACGCTTTTTTAATGAAATTTTTTAATCC
AATGGTGTTCTAAAAATTGTATTAGATCTTTTAAACAATTTGAAGTACCTTCATTGTTATCCACTTCGTGTTCTTTGTGCATAATTCAAGAGTTGTCCATATCCTAATGGGCCTTTCTCC
ATCTAACATGCCGTCTCTATTTCAAACTTGATATTTAAGCTTGATCCATTTTTCTCGATTAGATGCTTTTCTCTTTTCCTGTATGGGTTGGAAATTGTCTAGATCTTCAAGGTCATTCGA
GAAGACAAAATTCAGGCTAATTCTAGTAAATCAAAAAGTCGGTGACTCCCCTCTGTTGAATATTAAAGGACACGCCATGTTGCTAACCAAAAGCCTTGATTTAGAAAAACATCATAGCAC
AATCATTTTGTTTCTAGTCCGACAATTATTGGATGCATTATTTCTAGAGAGACGACACAAATTAAAGTCAAAAGGCACGAGAAAGAGTGTCATTCCCGTCCAAACTGGTGTCTGCAGGCG
TTCATAATGGGGGACAAAAGGGGGAAAATGATAAGGGAAATTAATCAGTGTTCATACTTTATGTTCAGGAAAAGTTATAGCACTCGTTCTGTTTATATTTTGACCGTTGAATCTAATGAA
TTCAATAGGATCGATTTGACTAATTAACGATGTGTGGCACAAAATATACAATAGGGATGCGACGCATCTGTTCTATTGGACGACACTGCAAACTTCACTGGGGAGAAGAATGCTGGCCCA
AATGCCAATTCCTTACGGGGATTCAACGTGATTGACACAATCAAATCCCAATTGGAGAGTGCATGCCCCGGCATCGTGTCCTGCGCTGATCTCTTGACCGTGGCTGCGCGAGATTCCGTC
GTCGCTGTAAGTGCACACTGTTTTCTTAATTCTAGTGATCAATTGTGATGAGAAAAAATCACTCGTTCTGATCTCGATACCGCATCAATACTAACACGTGTGGATTTGTTTAACTATTTA
ATTCTTAGTTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGAAGAGACTCAACCACTGCAAGCC
AAAGTGCTGCTAATAGCAACATCCCTGCCTTTACTTTGAGCCTTAGCGGCCTCA
TCACTGCCTTCTCTAACAAAGGTTTCACTGCCAAAGAAATGGTGGCACTCTCAGGTCATTATTTTACTTTTTTTTGTGGCACCTTTTAATAACGAATTTACAATTATGCTTGATCGATAT
ACTAAGATTAATATTAAAAAGTTGTTCGATTGTTGTTAACAGGGTCGCACACGATAGGTCAAGCCCGATGCACAACTTTCCGGACCCGTCTTTACAACGAGAACAACATCAACG
CCACGT
TCGCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGCGACAACAATCTCTCTCCTCTAGACACCACGAGCCCGACGTCCTTCGACAATGCCTACTTTAAGAACTTGCAAATCCAAA
AAGGTCTTCTTCACTCGGATCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAAGTGAACGCTTATAGCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGA
TGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGAGTTGCGGGAAAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCTTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
TCCGTCGTCGCTGTAAGTGCACAC
TGTTTTCTTAATTCTAGTGATCAATTGTGATGAGAAAAAATCACTCGTTCTGATCTCGATACCGCATCAATACTAACACGTGTGGATTTGTTTAACTATTTAATTCTTAGTTAGGTGGCC
CAAGTTGGACAGTCCCGCTAGGAAGAAGAGACTCAACCACTGCAAGCC
TTTTTTTGTGGCACCTTTTAATAACGAATTTACAATTATGCTTGATCGATATACTAAGATTAATATTAAAAA
GTTGTTCGATTGTTGTTAACAGGGTCGCACACGATAGGTCAAGCCCGATGCACAACTTTCCGGACCCGTCTTTACAACGAGAACAACATCAACG
AGAACTTGCAAATCCAAAAAGGTCTT
CTTCACTCGGATCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAAGTGAACGCTTATAGCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAAC
CTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGAGTTGCGGGAAAGTCAACTAA

Retrieve as FASTA