Entry information : EglPrx24
Entry ID 10844
Creation 2012-05-02 (Qiang Li)
Last sequence changes 2012-05-02 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-13 (Christophe Dunand)
Peroxidase information: EglPrx24
Name EglPrx24
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx24
start..stop
S start..stop
EgrPrx24 644 0 1..318 1..318
EguPrx24 640 0 1..318 1..318
EcamPrx24 635 0 1..318 1..319
EgrPrx25 569 0 1..318 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..216 216 N° 2 1937..2125 189 N° 3 2475..2640 166 N° 4 2747..3132 386
join(1..216,1937..2125,2475..2640,2747..3132)


exon

Literature and cross-references EglPrx24
Protein sequence: EglPrx24
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (293)
PWM (Da):   %s   33552.36 (30955.0) Transmb domain:   %s   o10-32i
PI (pH):   %s   6.64 (6.65) Peptide Signal:   %s   cut: 26 range:26-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACESSSVKPVYLLLLCFLLGTASAQLSSTFYSKSCPSALRTIKSGVSSAVFSEARMGASLLRLHFHDCFVNGCDASILLDDTTNFTGEKTAGANNNSIRGYEVIDTIKSHLESSCPGVVSCADILAIAARDSVVLGGPSWTVLLGRRDSTTASLTDANSDIPAPTLSLSDLITSFSNKGFTAKEMVALSGSHTIGQARCTSFRTRLYNENDINATFATSLNANCPSSGGDNNLSPLDTTSPTYFDNAYFKNLQTQKGLLHSDQQLFSGGSTDAQVNTYSSNSATFMTDFANAMVTMGNLSPLTGSSGQIRKNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCTGTCAAACCCGTCTACTTATTGTTGCTGTGTTTCCTCCTCGGAACAGCCTCAGCTCAGCTGTCCAGCACTTTCTACTCCAAATCCTGTCCCAGCGCCCTC
CGCACCATTAAGTCTGGCGTGAGCTCCGCCGTGTTCAGCGAGGCCCGCATGGGCGCATCACTGCTCCGCCTTCACTTCCACGATTGCTTTGTCAAT
GCAAGTCCCTCTCCTCTGTGTCTG
TCCTCTCTTTCCCATTGATTTCTACCTTTGTCTCCCTTCTGTCATTCAAGCTTCATGCAAGCGTGCATGCATGATGCATCTTTGCGCCTGTACTTGTGAAACATTCCAACCAACCTCATA
GTCAGGAGCATCATTAGATTTCGCTTCTACGCATTGAATTAGTCGAGTCTGACCGACCCCTCTTGGTATATTGTCGTGCCATGCATTTTTGCGAGTCTATTAGCATAATAATAACAGGAT
CTGTTTATTGAAGTCGTTTTAGAATTAGAGCCATGTTTTCATCATACAGCAATAAAAGGCATGGCCCTTAGAATAAAAGCACTTCTTTTTGGTGATTCAAAGAGAAAATTTTCATGAGTA
ATTCTAGCATACACCGCTAGTGTAAAAATATCATTCCATAAGCGGCCTTATCCACTAGATATTTTGGTGGTTAGGAAGAGATTTGGTAATTATAATCCTCCAATCATGGGTGGATAAGAA
TGTTGTTGTGTGTACTCTAATCTTTTTTTTTAAATTACAGACAGTATATGCTCTACTTTTCTTTATTACAAAAGCCATGCAGGTGAACGTACTTTGTGCTGAGTATTTGTTGACAAGATG
TGTGTATGTGTATGATTAGCCCTGGTTTAAACCCGATGAACTCGATGATTTAGATCATGCAAAAGTCCTAAACGTTGCAGCTGGAAAAGAGAGAGAGAGATGGCCATGCTTTATAAGTCG
GTGGTTGACTTTATGCGAACATCGCGTTTGGCAAAACCAATCAGTCTTTCTCAATAGGTTTCAATCATATTTTGATCACCGTCCTTTGGTTGCGATACTTTTCTACATTAAAAATCATGT
TTTATGGTAAAAGATCATTTTTAATGGAATTTGTTAATCCAATGGTATTCTAAAAATCACATTAGATCTTTGAATGAATGAATTGTGCCTTGTGCATGGCCTCACTAGTTTGCTTCCAAC
ACGAATTTAGAGTGACAATCTAAATTAACAAATCAATTTAGTATACCTTCTTTGTAATCCTCTTTGTATTCTTTGTGCATAATTTAAGAGCTGCCCACATCATAATGGACCTTTCTCCAT
CAAACATGGCGTCTCTATTTTGATCTTGATATTTAAAGCCTAATCGATTTTTTAAATAACAAATATGATGTGTTTACAACTTTCTCGATTAGATTTGTGGGTTGCTTTTCCTTTTTCCTG
TATAGGTTGGAAATCGTCTAGATTTTCAATTTTAATCGATAGATAATTGGTCATTTGAGAAGGCCAAACTCAGGCTAATTCTAGTGAATCATAAAGTCGCTGACTTTCCTCTGTTAAATA
TTAAAGAACGCGCCATGTTGCTAACCAAAAATCTTGATTTAGAGAACTCTTCACAGCGCAATCATTTTGTTTCTAGTCCGACGATTATTGGATGCATTGTTCCTTGAGAAACAACACGGA
GTAAAGTCAAAAGGCACGANNNNNNNNNNNNNNCCCCCCGCCGCGCGGTCCAAACTGGTGTCTCTAGGCGTTCATAATGGGGGACAAAAAGGGGAGAACGATAAGGGAAACAACCAGTGT
TTATGCTCTAACTTCAGAAAAAAATTAAAACACTCAAACCTCCTGTCTACAACTAACGAATGAAATGAATGCCAATCGGATCAATTTTCCATCTAGAAGGGCTGATTAATAATGTGTGGT
GTAAAATATGAAATAGGGATGTGACGCGTCGATTTTGTTGGATGACACCACGAACTTCACTGGGGAGAAGACTGCCGGGGCGAATAACAATTCCATACGGGGATACGAGGTGATTGACAC
GATCAAGTCCCATCTAGAGAGCAGCTGCCCTGGGGTCGTGTCTTGTGCAGACATCTTGGCCATCGCCGCGCGTGATTCTGTTGTT
GCTGTAAGTGCACATTTTCTTCTCAACACTAGCAA
TCAATTGGGAGGAAAAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCAAAAAAAAAAAAGAGGA
AAAAATCACATGCTATATTACCTATCTATATTAGTACTAACATGTTTGGATTTATTTGTTTATTTAATTTTCAGTTAGGTGGCCCAAGTTGGACAGTCTTATTAGGAAGAAGAGACTCGA
CCACTGCAAGCCTAACTGATGCTAATAGCGACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACTTCCTTCTCTAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GTCATTATTATTATTATTATTTTGCATTTTATAATAAATAATTATAATAAAGTTCGACTGATATACTATGATCAATTTACAAAAACTGTTCGATTGTTGTTAATAGGATCGCACACGATA
GGTCAAGCCCGATGCACAAGTTTCCGAACCCGGCTTTACAACGAGAACGACATCAACGCCACATTCGCAACGTCACTAAACGCAAACTGCCCAAGCTCCGGAGGTGACAATAATCTCTCT
CCTCTCGACACCACGAGCCCGACGTACTTCGACAATGCCTACTTCAAGAACTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAACAATTGTTCAGTGGTGGTTCCACGGACGCTCAA
GTGAACACTTACAGCAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGACGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAAATTAGGAAGAATTGCAGG
AAAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCTGTCAAACCCGTCTACTTATTGTTGCTGTGTTTCCTCCTCGGAACAGCCTCAGCTCAGCTGTCCAGCACTTTCTACTCCAAATCCTGTCCCAGCGCCCTC
CGCACCATTAAGTCTGGCGTGAGCTCCGCCGTGTTCAGCGAGGCCCGCATGGGCGCATCACTGCTCCGCCTTCACTTCCACGATTGCTTTGTCAAT
GGATGTGACGCGTCGATTTTGTTG
GATGACACCACGAACTTCACTGGGGAGAAGACTGCCGGGGCGAATAACAATTCCATACGGGGATACGAGGTGATTGACACGATCAAGTCCCATCTAGAGAGCAGCTGCCCTGGGGTCGTG
TCTTGTGCAGACATCTTGGCCATCGCCGCGCGTGATTCTGTTGTT
TTAGGTGGCCCAAGTTGGACAGTCTTATTAGGAAGAAGAGACTCGACCACTGCAAGCCTAACTGATGCTAATAGC
GACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACTTCCTTCTCTAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GATCGCACACGATAGGTCAAGCCCGATGC
ACAAGTTTCCGAACCCGGCTTTACAACGAGAACGACATCAACGCCACATTCGCAACGTCACTAAACGCAAACTGCCCAAGCTCCGGAGGTGACAATAATCTCTCTCCTCTCGACACCACG
AGCCCGACGTACTTCGACAATGCCTACTTCAAGAACTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAACAATTGTTCAGTGGTGGTTCCACGGACGCTCAAGTGAACACTTACAGC
AGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGACGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAAATTAGGAAGAATTGCAGGAAAGTCAACTAA

Retrieve as FASTA