Entry information : EglPrx25
Entry ID 10847
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2012-05-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-13 (Christophe Dunand)
Peroxidase information: EglPrx25
Name EglPrx25
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx25
start..stop
S start..stop
EgrPrx25 648 0 1..319 1..319
EcamPrx25 613 0 1..319 1..322
EguPrx25 607 0 1..319 1..319
EcamPrx24 591 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..216 216 N° 2 1708..1899 192 N° 3 2019..2184 166 N° 4 2289..2671 383
join(1..216,1708..1899,2019..2184,2289..2671)


exon

Literature and cross-references EglPrx25
Protein sequence: EglPrx25
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33693.41 (31097.1) Transmb domain:   %s   i12-34o
PI (pH):   %s   6.34 (6.34) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACENSSPRSAFLLLLCFLLGTASARLSSTFYFTSCPSALHTIKSGVNSAVSSEARMGASLLRLHFHDCFVNGCDASILLDDTTNFTGEKTAGANDNSIRGYEVIDTIKSQLESSCPGVVSCADILAVAARDSIVALGGPSWRVLLGRRDSTTASLSAANSDIPAPTLSLSDLITAFSNKGFTAKEMVALSGSHTIGQARCTTFQTRLYNESDINSTFATSLKEDCPSSGGDNNLSPLDTTSPTYFDNAYFKNLQTQKGLLHSDQQLFSGGSTDAQVNTYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKNCRKL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGATCCGCCTTCTTATTGTTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTTCACATCCTGTCCCAGCGCCCTC
CACACCATTAAGTCCGGCGTGAACTCCGCAGTGTCCAGCGAGGCCCGCATGGGCGCCTCACTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GCAAGTCCCTCTCCTCCGAGTCTC
TCCTCTCTTTCCCTTTGATTTCTACCTTTGTTTCTCTTCTGTCATTCAAGCTGCATGCAAGCGTGCGTGCATGATGCATCTTTATGCCTGTGCTTGTGAAACATTCCAACCACCCTCATA
GTCAAAGGCATCATTAGATTTCGCTTCTACGCAATTAATGTACTCTCTTTTTCGCTAATTAAAACAGTAGGTACGAGATTCGCATATTGAATTAGTCGAGTCTGACCGACCTTTTTGGTG
TATTGTTGTGCCATGCATTTTTGTGAGTTTATCAAAGGTGGACAAGAATGTTGTTGTGTATACTCTTAATTTTTTTATTACAGAGACAATATATGCTATAATTTTCTTTATTATAAAAGC
CATGCAGGCGACGTACTTTATGCTGATCACGCTGTTGATAAGATGTGCATGTATGATTAGCTACCTGTTTTAAACCCGATGAACTCGATGATTTAGATCATGAAAAAGTCCTAAACGTTG
CAGCTGTAAAAAGAGAAGAGAGAGACGGCCATGTTTTTTAAGTCAAATACGCGTTTATCACGTTTGGCAAAACCAATCAGTCTTTCTCAATAGGTTTCAATCATATTTTGATCACCATCC
CTTTGGTTGCCATACTTTTCTAAATTTAAAATGATATTTTATGGTAAAATATCAGTTTTAATGGAATTTGTTAATCCAATGGTATTCTAAAAATCATATTAGATCTTTGAATAAATGAAT
TTCGCCTTGCGCATGGCCTCACTAGTTTGCTTCCAACACAAATTTAGAGTGTCAATCTAAATTAACTAATTGATTTAGTGTACCTTCTTTGTGTTCTTTGTGCATANNGTAAGAGTTGCT
TGCATCCTAATGGATCTTTCTCCATCAAACATGCCATCTCTACTTTGATCTTGATATTCATAGGCTGATCTATTTTTTAAATAACAAATATGACATGTTTACAACTTTCTCGGTTAGATT
TGTGGGTTGCTTTTCTTTTTCCTATATAGGTTGGAAATTGTCTAGATTTTCATTTTTGATCGATACATAATTGGTCATTCGAGAAGGCCAAACTTAGGCTAATTCTAGTGAATCATAAAG
TCGGTGACTCCCCTCTGTTATATATTAAAGAACGCGCCATGTTGCAAACCAAAAATCTTGATTTAGAGAACTCTTCACAGCGCAATCATTTTGTTTCTAGTCCGACGATTATTGGATGCA
TTGTTCCTTGAGAAACAACAGGGAGTAAAGTCAAAAGGCATGAGCAAGAGTGTCACCTTCGTCCAGATTGGTGTCTCTAGTCGTTAATAGTGGGGGACAAAAAGGGGGAATGATAAGGGA
AACAACCAGTGTTTATGCTCTCATTTCAGGAAAATTTATAACAACCAAACCTCCTGTCTACAACCAATGAATGAAATGAACGCCAATTGGATCGATTTTCCAACTAGAAGGGCTGATTAA
TAATGTGTGGTGCAAAATATGAAACAGGGATGTGACGCGTCGATTCTGTTGGACGACACCACGAACTTCACTGGGGAGAAGACCGCCGGCGCGAATGACAATTCCATACGTGGATACGAG
GTGATCGACACGATCAAGTCCCAACTGGAGAGCAGCTGCCCTGGGGTCGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTATTGTTGCC
GTAAGTGCACATTTTCTTCTC
AACACTAGCAATCAATTGGGAGGAAAAAATCACATGCTATGTTACCTTTCTATATTAGCACTAACATGTTTGGATTTATTTGTTTATTTAATTTTCAGTTAGGTGGCCCAAGTTGGAGAG
TCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGTGCTGCTAATAGCGACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAAAGGCTTCACTG
CCAAAGAAATGGTGGCACTTTCAG
GTCTTTCTTTTTTTTTTGGTTGCATTTTATAATAAAGAATTATAATAAAGCTCGACTGATATACCAAGATCGATTTACAAAAACTGTTCAATTGTT
GTCAATAGGATCGCACACGATAGGTCAAGCCCGATGCACAACTTTCCAGACCCGGCTTTATAATGAGAGCGACATCAACAGCACGTTCGCAACGTCACTAAAAGAAGACTGCCCAAGCTC
CGGAGGTGACAACAATCTCTCTCCTCTCGACACCACAAGCCCGACGTACTTCGACAACGCCTACTTCAAGAATTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAGCAATTGTTCAG
TGGTGGTTCCACAGACGCTCAAGTGAACACTTACAGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCACTCACCGGCTCAAGCGG
TCAGATTAGGAAGAACTGCAGGAAACTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGATCCGCCTTCTTATTGTTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTTCACATCCTGTCCCAGCGCCCTC
CACACCATTAAGTCCGGCGTGAACTCCGCAGTGTCCAGCGAGGCCCGCATGGGCGCCTCACTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GGATGTGACGCGTCGATTCTGTTG
GACGACACCACGAACTTCACTGGGGAGAAGACCGCCGGCGCGAATGACAATTCCATACGTGGATACGAGGTGATCGACACGATCAAGTCCCAACTGGAGAGCAGCTGCCCTGGGGTCGTG
TCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTATTGTTGCC
TTAGGTGGCCCAAGTTGGAGAGTCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGTGCTGCTAAT
AGCGACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GATCGCACACGATAGGTCAAGCCCGA
TGCACAACTTTCCAGACCCGGCTTTATAATGAGAGCGACATCAACAGCACGTTCGCAACGTCACTAAAAGAAGACTGCCCAAGCTCCGGAGGTGACAACAATCTCTCTCCTCTCGACACC
ACAAGCCCGACGTACTTCGACAACGCCTACTTCAAGAATTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAGCAATTGTTCAGTGGTGGTTCCACAGACGCTCAAGTGAACACTTAC
AGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCACTCACCGGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAAACTCAAC

Retrieve as FASTA