Entry information : EglPrx32
Entry ID 10855
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: EglPrx32
Name EglPrx32
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx32
start..stop
S start..stop
EgrPrx32 664 0 1..323 1..323
EguPrx32 657 0 1..323 1..323
EgrPrx41 593 0 6..323 4..321
EgrPrx38 592 0 6..323 4..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 347..541 195 N° 3 678..1226 549  
join(1..228,347..541,678..1226)


exon

Literature and cross-references EglPrx32
Protein sequence: EglPrx32
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35593.16 (33229.8)  
PI (pH):   %s   9.06 (8.89) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALGSLSLFRALLFLSLTASALSTRPYKNGLSPDFYDYVCPQALPTIKRVVEAAVQQERRMGASLLRLHFHDCFVNGCDRSILLDPTPTIDSEKLAFPNNNSARGFEVIDQIKAEVDRVCGRPVVSCADILAVTARDSVVALGGPSWKVRLGRRDSMTASRTTANSDIPAPNMDLPALINNFKRQGLKVKDLVALSGAHTIGFAQCRVFRDRIYNDSNINHAFAKNLQSSCPRTGSDTNLASLDPSPARFDTLYYNNLLTQKGLLHSDQALSTDESTLELVKSYSYDYDAFWKDFAKSMVRMGNIKPLIGNQGQIRSNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from NGS (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTTCGAGCACTTCTCTTCTTGTCCCTCACGGCCTCGGCTCTCTCGACGCGCCCCTACAAGAATGGTCTCTCGCCAGACTTCTACGACTATGTCTGT
CCTCAAGCCTTGCCCACCATCAAGCGTGTCGTCGAGGCAGCGGTGCAGCAAGAAAGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTCCACGATTGTTTTGTCAAT
GTAAGACATATA
CTGCTAAATTTCACGTTAATTTGTTGTTCTCAAAAATAGTGATTACTATTTAGCAGTGCACAATATTTGCTGAACATTATGTATGTTTGGGCGTTGAATGATGCAGGGTTGTGATAGGTC
GATACTTTTGGATCCAACCCCAACCATTGACAGCGAAAAGCTTGCGTTTCCTAATAACAATTCAGCTAGAGGATTCGAAGTGATCGACCAAATTAAGGCAGAGGTTGACAGAGTATGCGG
ACGTCCGGTGGTATCTTGTGCGGACATCTTGGCTGTCACTGCTCGTGACTCCGTTGTTGCG
GTACGTCTAGTTTTACTACGTCCAATGATGCTTAATTAGCAAATCTGAATTTAGACTCA
TCATAAGCTTAGTTGGCTTTTTTGTGCCTTAAGACATTGCCAATCTGAACTAGGCGCTATACTTCATTCAATTTCAGTTAGGGGGGCCTTCGTGGAAAGTACGACTTGGACGAAGAGACT
CGATGACGGCGAGCAGGACAACGGCAAACAGCGACATTCCTGCACCAAACATGGACTTACCTGCCTTAATTAACAATTTCAAGAGACAAGGTCTTAAGGTCAAGGACTTGGTTGCACTAA
GCGGTGCTCACACGATTGGCTTCGCACAGTGCCGTGTTTTCAGGGACAGGATATACAATGACAGCAACATCAACCACGCTTTTGCGAAGAACCTCCAGTCCTCCTGCCCACGCACGGGAA
GCGACACAAACCTTGCAAGTTTAGATCCATCGCCGGCACGTTTTGACACGTTGTACTACAATAACCTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTTTCAACTGATGAAT
CCACACTTGAGCTAGTGAAGAGTTATAGCTACGATTATGATGCATTCTGGAAGGATTTCGCTAAATCGATGGTCAGAATGGGAAACATCAAGCCGTTGATCGGCAACCAAGGTCAAATCC
GCTCAAACTGCCGGAGAGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTTCGAGCACTTCTCTTCTTGTCCCTCACGGCCTCGGCTCTCTCGACGCGCCCCTACAAGAATGGTCTCTCGCCAGACTTCTACGACTATGTCTGT
CCTCAAGCCTTGCCCACCATCAAGCGTGTCGTCGAGGCAGCGGTGCAGCAAGAAAGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTCCACGATTGTTTTGTCAAT
GGTTGTGATAGG
TCGATACTTTTGGATCCAACCCCAACCATTGACAGCGAAAAGCTTGCGTTTCCTAATAACAATTCAGCTAGAGGATTCGAAGTGATCGACCAAATTAAGGCAGAGGTTGACAGAGTATGC
GGACGTCCGGTGGTATCTTGTGCGGACATCTTGGCTGTCACTGCTCGTGACTCCGTTGTTGCG
TTAGGGGGGCCTTCGTGGAAAGTACGACTTGGACGAAGAGACTCGATGACGGCGAGC
AGGACAACGGCAAACAGCGACATTCCTGCACCAAACATGGACTTACCTGCCTTAATTAACAATTTCAAGAGACAAGGTCTTAAGGTCAAGGACTTGGTTGCACTAAGCGGTGCTCACACG
ATTGGCTTCGCACAGTGCCGTGTTTTCAGGGACAGGATATACAATGACAGCAACATCAACCACGCTTTTGCGAAGAACCTCCAGTCCTCCTGCCCACGCACGGGAAGCGACACAAACCTT
GCAAGTTTAGATCCATCGCCGGCACGTTTTGACACGTTGTACTACAATAACCTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTTTCAACTGATGAATCCACACTTGAGCTA
GTGAAGAGTTATAGCTACGATTATGATGCATTCTGGAAGGATTTCGCTAAATCGATGGTCAGAATGGGAAACATCAAGCCGTTGATCGGCAACCAAGGTCAAATCCGCTCAAACTGCCGG
AGAGTGAATTGA

Retrieve as FASTA