Entry information : EglPrx[P]40
Entry ID 10862
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2016-03-13 (Christophe Dunand)
Peroxidase information: EglPrx[P]40
Name EglPrx[P]40
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx[P]40
start..stop
S start..stop
EgrPrx[P]40 209 4e-72 1..109 1..131
EguPrx[P]40 186 1e-62 1..109 1..131
EglPrx32 162 3e-51 1..109 1..132
EgrPrx32 162 4e-51 1..109 1..132
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..225 225 N° 2 344..511 168  
join(1..225,344..511)


exon

Literature and cross-references EglPrx[P]40
Protein sequence: EglPrx[P]40
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   109 (86)
PWM (Da):   %s   11996.17 (9632.8)  
PI (pH):   %s   6.5 (6.07) Peptide Signal:   %s   cut: 24 range:24-109
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALGSLSLFRALLFLSLTASALSTRPYNNGLSPHYDYECPQALATIKRVIEEMVQQERRMGASLLRLHFHDCFVNGRDALMLLDPTLAIDNEKLALHGCLVVSCAEILA

Retrieve as FASTA  
Remarks Pseudogene sequence from NGS. 3' is missing due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTCCGAGCACTTCTCTTCTTGTCCCTCACGGCGTCAGCTCTCTCGACGCGCCCCTACAACAACGGCCTCTCGCCACACTATGACTATGAATGCCCT
CAAGCCTTAGCCACCATCAAGCGCGTCATTGAGGAGATGGTGCAGCAAGAGCGACGCATGGGTGCGTCCTTGCTGCGCTTGCACTTCCACGACTGTTTCGTCAAT
TTTAGCATTGCACAA
TACTTGCTAACATTGATGTTTGTTTGGGAGTTCAATAATGCAGGGCCGTGATGCATTGATGCTCTTGGATCCGACCCTGGCCATCGACAATGAAAAGCTTGCGCTTCATGGATGTCTGGT
GGTATCTTGTGCGGAAATCTTGGCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTAGGTAGCCTCAGCCTCTTCCGAGCACTTCTCTTCTTGTCCCTCACGGCGTCAGCTCTCTCGACGCGCCCCTACAACAACGGCCTCTCGCCACACTATGACTATGAATGCCCT
CAAGCCTTAGCCACCATCAAGCGCGTCATTGAGGAGATGGTGCAGCAAGAGCGACGCATGGGTGCGTCCTTGCTGCGCTTGCACTTCCACGACTGTTTCGTCAAT
CTTCATGGATGTCTG
GTGGTATCTTGTGCGGAAATCTTGGCA

Retrieve as FASTA