Entry information : EglPrx52
Entry ID 10873
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2012-05-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-13 (Christophe Dunand)
Peroxidase information: EglPrx52
Name EglPrx52
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx52
start..stop
S start..stop
EgrPrx50 678 0 1..333 1..333
EgrPrx52 676 0 1..333 1..333
EcamPrx50 672 0 1..333 1..333
EguPrx50 610 0 1..333 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..225 225 N° 2 334..525 192 N° 3 653..818 166 N° 4 1519..1937 419
join(1..225,334..525,653..818,1519..1937)


exon

Literature and cross-references EglPrx52
Protein sequence: EglPrx52
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   35627.73 (32799.2)  
PI (pH):   %s   5.05 (5.05) Peptide Signal:   %s   cut: 29 range:29-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGSSTPSSLTAVTLLAALLLFLNPSNAQLTANFYAKTCPSVSSIVQTVIQEALQSDPRITASLLRLHFHDCFVDGCDGSLLLDNSPTIKSEKDAAPNFKSARGFDVVDKIKAAIESACPGTVSCADILALAAQASVSLSEGPYWTVLLGRRDSLTANQAGANTSIPSPFDSYNNLVSKFSAVGLDITDLATLSGAHTFGRAQCKSFNPRLYNFTANGGPDPTINPWYLTNLRKLCPQNGDSSVLADLDPTTPNLFDNHYYSNLQKNEGLLLSDQELYSTTGAATISIVNSFSFDQSAFFESFARSIVNMGNISPLTGSNGEIRFNCRKVNWS*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCGTCGAACGCTCAACTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGACCCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GTGAGTCCCTAAGCT
AGATCAATTCCCATTAACAATNNNNNNNTCAATCTGATTACCAAGTAGCTAGTCACGCAACCTAATGTTTAAGCCTGACATGTGTGTTAAAAGGGGTGTGATGGATCGCTGCTGCTGGAC
AATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATCGAGAGTGCTTGTCCAGGGACCGTGTCT
TGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
GTATATGTAGTTATAGTCAAAGAAACATAAACATAAATCTAAAGTATATTCAGGGTTCATTATTATAACTCACCC
TACTCAAATCATTATTGTATTTCTCTTGATTATCACTCTTACCAAATTGCAGTCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCCGGAGC
GAACACATCGATACCCTCCCCTTTTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
GTAAAAAAGAACAATTGGACTT
GCATTTTAATACGAAACGTGCAACTGTAGATATTGATGCACAAAAAAGATTTATAGAGTGAGATGCTGGATTTTTGTCACATAATTTATCGGCACAAACATCTCTTCACTTTTGTTTAAC
ACATTCTAACTTCCTTATATGATCATGGTCTAAGATTAATGCACATCTACGAGAAGGAATTTTGGCTAAGGATTATTAATCTATAATTGAATAAGTAATTTGCCCTTGACTTGAGATCGA
TTGACATGCATGTGTTATGCCTAGGCCATGCCTGTATCGTGCATGGACCATGCACATCTACTAGAACGAATTTTGGCTAAGGATTAAGGATTTCTTTTTCATCACAAGAGTATGAATATC
GGGAAAGATGGTATCAAAATTTGCAAGCCCCTCATGTACTTATCCAAGAAATGCTATGTTTACATAATCAATATATTAAGTGATGTCGCAAATCGTTATTACTTATTCATATATCCACTA
ATGAGTTTGCTGCATATGTTTGGCATACAAATTCCGTTGAGCATTCCTAGCATTGATCTATTCATCCATCTCCATAATTAAGCATCTGCAGATANNNGTTCTCTTAGCTAACTTTTCGTG
CATACGACAATAAAACAGGAGCTCACACCTTCGGACGTGCACAGTGCAAGTCATTCAACCCTAGGCTCTACAACTTCACCGCGAACGGTGGCCCTGATCCCACCATAAACCCGTGGTACT
TGACCAATCTCCGGAAACTTTGCCCTCAGAATGGCGACAGTAGTGTCCTCGCCGACCTCGACCCGACAACCCCAAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGAAG
GGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACAACTGGCGCCGCAACAATTTCCATCGTCAACAGCTTTAGCTTTGACCAGAGTGCCTTCTTCGAGAGCTTCGCTCGGTCGATAGTAA
ACATGGGAAATATTAGTCCTCTCACCGGAAGTAACGGGGAGATCCGGTTCAATTGTAGGAAGGTCAATTGGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCGTCGAACGCTCAACTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGACCCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GGGTGTGATGGATCG
CTGCTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATCGAGAGTGCTTGTCCA
GGGACCGTGTCTTGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
TCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCC
GGAGCGAACACATCGATACCCTCCCCTTTTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
CCGCGAACGGTGGCCCT
GATCCCACCATAAACCCGTGGTACTTGACCAATCTCCGGAAACTTTGCCCTCAGAATGGCGACAGTAGTGTCCTCGCCGACCTCGACCCGACAACCCCAAACTTGTTTGACAACCACTAC
TACTCCAACCTCCAGAAAAATGAAGGGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACAACTGGCGCCGCAACAATTTCCATCGTCAACAGCTTTAGCTTTGACCAGAGTGCCTTCTTC
GAGAGCTTCGCTCGGTCGATAGTAAACATGGGAAATATTAGTCCTCTCACCGGAAGTAACGGGGAGATCCGGTTCAATTGTAGGAAGGTCAATTGGAGTTGA

Retrieve as FASTA