Entry information : EglPrx53
Entry ID 10875
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-15 (Christophe Dunand)
Peroxidase information: EglPrx53
Name EglPrx53
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx53
start..stop
S start..stop
EguPrx51 686 0 1..334 1..334
EgrPrx53 686 0 1..334 1..334
EgrPrx54 676 0 1..334 1..334
EcamPrx53 673 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 361..552 192 N° 3 679..840 162 N° 4 2297..2719 423
join(1..228,361..552,679..840,2297..2719)


exon

Literature and cross-references EglPrx53
Protein sequence: EglPrx53
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   36062.1 (33069.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.38 (5.93) Peptide Signal:   %s   cut: 30 range:30-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSTLSSPTVVALFAAALLFLLHPLNAELTADFYAKTCPDVSSIVQTVIHEALQYDPRITASLLRLHFHDCFVQGCDGSVLLDNSPTIKSEKDAAPNFNSARGFGVVDKIKAAIESTCPETVSCADILALAANASVYLSGGPYWTVLLGRRDSLTANQGLANTSIPSPFESYANLTSKFYVLGLDITDLVTLTGAHTFGRAHCKSFTPRLYNFTKNGGPDPTLSPWYLTALQKLCPPNFNPKVITDLDPTTPNLFDNHYYSNLQKNDGLFETDQELYSTAGAATVPIVNSFSADQSAFFKSFTRSIVNMGNISPLTGSNGEIRCNCRKVNKS*

Retrieve as FASTA  
Remarks Complete sequence from NGS (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCACCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAG
GTGAGTCCCTAC
ACTAGATCAATTCCCATTGACAATGAGTTCCAACTTACCGCATTCTTTTTACAGTACTTTCGATCTGATTATCGAGTTATTAGTCACGTAACCTAATGCTTGAGCATGACGTGTTTAAAG

GGGTGTGATGGATCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATT
GAGAGCACTTGTCCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
GTATGTGTCGTTTTAGTCAAAGAAACATAAAACATATTTAAAGTATAC
TTAGGATTCATTATTGTCACTTGGCCTACACGAATTATAATTGTGTTTCTCTTGATTATCACATTTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGAC
AGCTTGACGGCGAACCAAGGACTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTN
NNNNNNNNNNNNNNACAGTTGGACTTGCATTTTGATGCGAACATGCAACTACAGATATTGATGCACAAAATAGATTAACAGAGTGAAATGTCGGATTTTTGTCACATAAGTTATCGGCAC
AAACATCGCATCACTTTCATTTAGCACATTTCAACTTCCTAATATGATCAAGGTCTCTTCTTCATTGAGATCAACTGACAGGCATGGGCTGTGCATGTGCATGGGCCGTGCCCCGGCAAT
GCTATCTACTAGAAGGAATTTTAGTCAAGGATTAAGGGTTAAANNNNNTTTTTATCTAAAATTGAATTTAAGTAAAGAATCGTCCTAAAACATGTGATCGACTAAAGTGCATGTGTTGTG
CCTAGGCTGTACCTGGGTCGTGCATGGGCTATGCACATTTACTAGAAGGAATTTTGACTGAGGATTAATGATTTCTTTTTTACCAAAAATTGAAAAAGTAAAGGATTGCCCTTCACTTGA
GATCAACTGACGTGCATGCGTTGTGCCTGGGCCATGCCATGTTGTGCATGGGTATATAGATATATTAGAAGGAAGTTTAGCTAAAGGATTAAGGGTTTCTTTTCAATCTAAAATTGAATA
AGTAAAGGATTGCCCCGACTTAATTTCAGGAGTAGTTGTGTATCATCACTACTCTAAAAAAGATAGATTATTTAAAAACAATTTTTTGCATGACCGATACTTATCTCCTCGGTAAATTCA
AAAAGGAGAGGAAGCCGATGATATGCAATTTCATTAAATTAGAAATTATGGGTTCATACATTTGCAGGTCCATAATTTGCTAGTCCTTGATAAAAATGGTAATTCAATAGGGTTAGTTTG
ATTGAACTGAATGAGTATAGTTAAAATCTCCTTGTGTGGATCCCACTTATCTTTAATTCAAATGGATCTAAATCAAGCTCGTATCAGCAACTCTTTAAGTCTTATCTAGTATAACTTCAG
CTATCAAGACGAAGAAGTGGTCAATGATGACACTTCATCGTTCAATTCATGATGAGGTTCATAGCGTTGAAACCATCGAATTAATGTAATATTTTCTTTGTTGTGATTTGTTTTCAATCA
AACTAGTGTACTTTTATGTGTAATTTTTTNATTACAAATTTGAAAAATATATTCGTGTTCAATGGGTAATTTTATATTCCTAATATCATTACAAGAGTATAAATATTGGAGGAGGATGCT
ATCAAAATTTGNNNGCCCCTCACATACTTGTATGAGAAATGCCAAGTATACTGAGGTCATTTGATAGAATCAATAAAATAAGTGATGTCACATATCACTATTATTTATTTATATTTTTAC
TAACGAGTGTGTTGCATATGTTTAGTATACAAATTCTATTAAGCATTCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATGCAGATATTTTGTTCTCTTAGCTAATTATTCG
TGCATATCATAATAAAACAGGAGCTCACACCTTTGGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTA
CTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACTTCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGA
CGGGCTTTTTGAGACTGATCAAGAGCTGTACTCGACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGT
AAACATGGGAAACATAAGTCCTCTCACCGGAAGTAACGGGGAGATCAGGTGCAATTGCAGGAAGGTCAATAAGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCACCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAG
GGGTGTGATGGA
TCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGT
CCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACAGCTTGACGGCGAACCAA
GGACTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTN
ACAGGAGCTCACACCTTT
GGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAAC
TTCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTGAGACTGATCAAGAGCTGTACTCG
ACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATAAGTCCTCTCACCGGAAGT
AACGGGGAGATCAGGTGCAATTGCAGGAAGGTCAATAAGAGTTGA

Retrieve as FASTA