Entry information : EglPrx56
Entry ID 10878
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2012-05-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: EglPrx56
Name EglPrx56
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx56
start..stop
S start..stop
EgrPrx56 664 0 1..323 1..323
EcamPrx56 654 0 1..320 1..320
EguPrx56 643 0 1..323 1..323
EgrPrx102 597 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 305..493 189 N° 3 1031..1594 564  
join(1..219,305..493,1031..1594)


exon

Literature and cross-references EglPrx56
Protein sequence: EglPrx56
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   35306.87 (32513.2)  
PI (pH):   %s   8.4 (7.50) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVLALKPRSRVIFALLLAMVSLQTVQNATRHDPKVPARLLRMFFHDCFIRVWISTFLHAKSLSLSLSLSHVINISVRAFYVIDDAKAKLEMACPHTVSCADIIAIAARDVVTMVTTITPLASQFYLMTHIVFMIITINLPAPTFNVTQLLQSFAERGLGLKDLVALSGGHTLGFSHCSSFDARLHNFSSTHDIDPTLNHAFAQQLKNECPKPNRSRNAGQFLDATSSTFDNDYYRRLVAGEGVFGSDQALYSDYRTRWIVNLFAQDQSLFFSEFAASMVRLGNVGVRENGEVRIKCRAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCTTGCGCTGAAGCCTCGCTCTCGCGTGATTTTCGCCCTTCTACTGGCGATGGTTTCGTTGCAGACGGTTCAAAATGCCACAAGGCACGACCCCAAAGTCCCCGCTCGTCTC
CTAAGGATGTTCTTCCACGACTGTTTCATTCGGGTATGGATATCTACATTCTTACATGCAAAATCTCTCTCTCTCTCTCTCTCTCTCTCTCATGTCATT
GGATGGTGCGTACCCACAGGG
ATGCGATGCGTCGTTGTTGCTCGACTCTACTCCTGGAAACCAAGCAGAGAAAGATGGTCCTCCAAATATCTCGGTTCGAGCATTCTACGTGATCGATGATGCCAAAGCAAAGCTCGAAAT
GGCATGTCCACATACAGTCTCTTGTGCTGATATCATCGCCATTGCGGCTAGAGACGTAGTTACCATGGTAACAACCATAACTCCCCTAGCAAGCCAATTTTACCTCATGACGCACATTGT
GTTCATGATCATT
CCCATGTACTTCTCATAATGATTTTGAGATTTATTCTAAATCCAATATATAAGGCATATGAAGCTCGTTTGATTTCTACCTTGTTCACTAGATTAGTTCTAGCATGC
TCGCAATTACTACACAAGATTCACTCAAAAAACTCCAAACAACTGGTTTCTAATGAATTACAGCAACAAGTGAGTCCAGTAAACTCGACTATCATTTCAGAAAAAAGGCTAGACTATCGC
AGTTTTAGAAAGGCAGTATCTATGAAAATAAACCAGCATGCCCGAGAGAAAAAGGAAAAGAGTTTCAAATGGTTTCCTATCTTATTACTGCATTCTGTGGTCTTGTAGTTATCACTTGAT
TCGCTTAAAAAGTTATTCCCTCGATAAAAGAAAAATTACTAAGGTGCTCCACACATTGAACTAATTACTAACCCCTCGAGATAGTTATTATGGCATAATATTGCCTATTGTTTTCATTGT
TAAGGCTGGAGGGCCATCTTGGAACGTGCTGAAAGGCAGAAAAGATGGAAGAGTATCAAATGCTTCAGAGACGATCAACTTGCCGGCGCCAACCTTCAACGTAACCCAACTCCTTCAAAG
CTTTGCCGAAAGAGGCTTAGGCCTCAAGGACTTGGTTGCACTATCTGGTGGCCACACCCTGGGCTTCTCACACTGTTCCTCTTTCGACGCCCGGCTTCATAACTTCTCTTCGACTCATGA
CATAGATCCGACCTTGAACCATGCGTTCGCACAACAGCTGAAGAATGAGTGCCCTAAACCAAACAGGAGTCGAAATGCGGGACAGTTTCTGGATGCTACATCGTCAACTTTTGACAACGA
TTACTACAGAAGACTCGTGGCTGGTGAAGGTGTGTTTGGGTCAGATCAAGCACTGTATAGTGATTACAGGACAAGGTGGATTGTAAATTTGTTTGCCCAAGATCAAAGTCTGTTCTTCAG
TGAGTTTGCAGCTTCTATGGTAAGACTCGGAAATGTTGGAGTGCGAGAAAATGGAGAAGTGAGAATAAAATGCAGAGCGGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCTTGCGCTGAAGCCTCGCTCTCGCGTGATTTTCGCCCTTCTACTGGCGATGGTTTCGTTGCAGACGGTTCAAAATGCCACAAGGCACGACCCCAAAGTCCCCGCTCGTCTC
CTAAGGATGTTCTTCCACGACTGTTTCATTCGGGTATGGATATCTACATTCTTACATGCAAAATCTCTCTCTCTCTCTCTCTCTCTCTCTCATGTCATT
AATATCTCGGTTCGAGCATTC
TACGTGATCGATGATGCCAAAGCAAAGCTCGAAATGGCATGTCCACATACAGTCTCTTGTGCTGATATCATCGCCATTGCGGCTAGAGACGTAGTTACCATGGTAACAACCATAACTCCC
CTAGCAAGCCAATTTTACCTCATGACGCACATTGTGTTCATGATCATT
ACGATCAACTTGCCGGCGCCAACCTTCAACGTAACCCAACTCCTTCAAAGCTTTGCCGAAAGAGGCTTAGGC
CTCAAGGACTTGGTTGCACTATCTGGTGGCCACACCCTGGGCTTCTCACACTGTTCCTCTTTCGACGCCCGGCTTCATAACTTCTCTTCGACTCATGACATAGATCCGACCTTGAACCAT
GCGTTCGCACAACAGCTGAAGAATGAGTGCCCTAAACCAAACAGGAGTCGAAATGCGGGACAGTTTCTGGATGCTACATCGTCAACTTTTGACAACGATTACTACAGAAGACTCGTGGCT
GGTGAAGGTGTGTTTGGGTCAGATCAAGCACTGTATAGTGATTACAGGACAAGGTGGATTGTAAATTTGTTTGCCCAAGATCAAAGTCTGTTCTTCAGTGAGTTTGCAGCTTCTATGGTA
AGACTCGGAAATGTTGGAGTGCGAGAAAATGGAGAAGTGAGAATAAAATGCAGAGCGGTGAACTGA

Retrieve as FASTA