Entry information : EglPrx58
Entry ID 10880
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status partial
Reviewer Christophe Dunand
Last annotation changes 2016-03-17 (Christophe Dunand)
Peroxidase information: EglPrx58
Name EglPrx58
Class Class III peroxidase     [Orthogroup: Prx013]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx58
start..stop
S start..stop
EgrPrx58 335 2e-119 1..174 31..218
EcamPrx58 310 9e-108 1..174 136..323
EcamPrx176 284 1e-97 1..174 136..320
EgrPrx176 247 7e-84 1..155 124..289
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..57 57 N° 2 100..169 70 N° 3 1583..2001 419  
join(1..57,100..169,1583..2001)


exon

Literature and cross-references EglPrx58
Protein sequence: EglPrx58
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   174
PWM (Da):   %s   18358.42  
PI (pH):   %s   10.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
QFKKSLWEVLTGRRDGRISNFTSLKQSFANKGLTLHDLVVLSGGHTIGVGHCNSFSKRLYNFIGKGGKGDQDPSLNPTYASQLKARCKTLSDTTTIVAMDPGSPLSFDNHYYTALNQNQGLFQSDAALLTNKESSKIVNKLLDQDRxxxxxxQSMKRMGTVQVLTGSNGEIRKK

Retrieve as FASTA  
Remarks Partial sequence from NGS. 5' and PS are missing due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAGTTCAAGAAGTCACTGTGGGAGGTGTTGACTGGAAGAAGAGACGGGAGAATCTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACTTCACGTCTCTCAAGCAA
TCTTTTGCCAACAAGGGCCTCACTCTTCATGACCTTGTTGTCTTATCAG
GTAAANNNNNNNNNNNNNNNNNNCACATTTTATATGGTAAAAAATTAGCCAAGTGCTCCTGGGTAGGTTGT
CCTAATGTCTAGTGAGTCAATTTTCCTTTTCAGGTCATTTATTTCTGCGTGTGTGAATATTTTCGTAAGAATGCAAATGCATTGTACCGGATTATCTTTGAAAAATATTTGATGAAATAC
CCTTTTCTCGTTTCTGAAAAGGGAAACCGATTGATCAATGTGATGGGTAAATGTTGCAAATTGGACCCCACTTTCAATTTTCTACGGGATGGGCAACCAGAACACAATATCCGTGGACAA
GCATTAGATTCGAAATTTCATATTTATGTAAATTCTATATAGTTTTTGGTCTTCCAATGAGAGAAACATAACTCGATGATATTATTTAAGCAAAAAAAAAAAAAAAACTCCATGGAAAGT
TCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTAAATTTCCGGTCCTGAAGGATATAAATCATGGATTTTCAATTC
TCCTACCATTTTCTGATTACGAAACGACTAAGCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAAAATCGAATACCATAAGTTGATGAAACGAATATTGTTTCATATTCATGATTATCTGAATTACATTCAATAATTGTTGTAGGTTTCACTTATTTTTATTT
TTCCTCCCTTTTAACTTACATTGGACAATTTTTATATTTTAAGGGAATCGAATTTTATAAAGTTTATGGCTTGTATATTTTACATTTTATTATCTAAAGTTTTAGAAAGGACAAAAAAAT
ATTTTTAATATTAAATGGAAATATCATAAGTGATATATACACACGCGCACACACTCGAACAAAGTAATCACTAATCAGAATAAGAAGAGAAGTTAAATTAATTTACTAATTAATTAAGTA
TACTACATATCTGGGCCATCAGGTGGCCACACAATTGGGGTCGGGCACTGCAACTCCTTCAGCAAGAGGCTCTACAACTTCATCGGCAAAGGCGGCAAAGGCGACCAAGACCCTTCCCTG
AACCCTACCTATGCCTCTCAACTGAAGGCCCGATGCAAGACGCTCTCCGATACCACCACCATCGTCGCGATGGACCCCGGAAGCCCCCTCTCCTTCGACAACCACTACTACACGGCATTG
AACCAAAACCAAGGCCTCTTCCAGTCCGACGCCGCGCTCCTGACCAACAAGGAGTCAAGCAAGATAGTGAACAAGTTGCTGGACCAGGACCGCTTNNNNNNNNNNNNNNGCCAGTCGATG
AAGCGGATGGGCACGGTCCAAGTGCTCACCGGGAGCAACGGCGAGATCCGGAAGAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAGTTCAAGAAGTCACTGTGGGAGGTGTTGACTGGAAGAAGAGACGGGAGAATCTCAAACTTCACGTCTCTCAAGCAATCTTTTGCCAACAAGGGCCTCACTCTTCATGACCTTGTTGTC
TTATCAG
TGAAGGCCCGATGCAAGACGCTCTCCGATACCACCACCATCGTCGCGATGGACCCCGGAAGCCCCCTCTCCTTCGACAACCACTACTACACGGCATTGAACCAAAACCAAGGC
CTCTTCCAGTCCGACGCCGCGCTCCTGACCAACAAGGAGTCAAGCAAGATAGTGAACAAGTTGCTGGACCAGGACCGCTTNNNNNNNNNNNNNNGCCAGTCGATGAAGCGGATGGGCACG
GTCCAAGTGCTCACCGGGAGCAACGGCGAGATCCGGAAGAAATGA

Retrieve as FASTA