Entry information : EglPrx65
Entry ID 10887
Creation 2012-05-04 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status partial
Reviewer Christophe Dunand
Last annotation changes 2016-02-05 (Christophe Dunand)
Peroxidase information: EglPrx65
Name EglPrx65
Class Class III peroxidase     [Orthogroup: Prx008]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx65
start..stop
S start..stop
EguPrx65 449 3e-163 1..228 1..250
EgrPrx65 449 4e-162 1..228 74..323
EguPrx66 422 3e-151 1..228 74..323
EgrPrx66 422 3e-151 1..228 74..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..192 192 N° 2 285..453 169 N° 3 533..924 392  
join(1..192,285..453,533..924)


exon

Literature and cross-references EglPrx65
Protein sequence: EglPrx65
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   228
PWM (Da):   %s   24081.17  
PI (pH):   %s   9.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCDGSILLDDTSSFQGEKTAGPNNKSLRGYNVIDRIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASFSLANSGALPPPTSTLSNLTSLFQAQGLSTRDMVALSGSHTIGQARCISFRSRIYNDSNIDSSFSKTRQGKCPSTVGSGDQNLAPLDLQSPTAFDNAYFKNLLKTYSNNPKTFNSDFASAMIKMGDIKPLTGSKGEIRKICSKVN

Retrieve as FASTA  
Remarks Partial sequence from NGS. 5' is missing due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGTGCGATGGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGTG
GAGTCCGCCTGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTCCTA
GTATGTGTTGCAATCGATATAGCTAGTTGCGCCTTTAGTCTGAGCTCC
TAATTTACTCTTATTATCAATTGATGGTGATGGGATATTTGAAGCTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCGAGGACCGCGAGCTTCTCACTCGCCAACAGCG
GAGCCCTTCCCCCTCCAACTTCAACGCTCTCCAACCTCACGTCTCTTTTCCAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCTCTGG
CCTCGCTCAGTTGCTAGGTTGCTCATGGGTCATGCATGGGCGTGCATTGCAGGGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGAAGTCGCATATACAACGACAGCAACATC
GACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCAGCACCGTTGGGTCTGGGGACCAAAACCTGGCTCCTCTCGACCTCCAATCTCCCACCGCCTTCGACAACGCCTACTTCAAG
AACCTGCTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCCGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGCAAGATC
TGTAGCAAGGTCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGTGCGATGGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGTG
GAGTCCGCCTGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTCCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCGAGG
ACCGCGAGCTTCTCACTCGCCAACAGCGGAGCCCTTCCCCCTCCAACTTCAACGCTCTCCAACCTCACGTCTCTTTTCCAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCT
G
GGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGAAGTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCAGCACCGTTGGG
TCTGGGGACCAAAACCTGGCTCCTCTCGACCTCCAATCTCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCCGATTTT
GCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGCAAGATCTGTAGCAAGGTCAATTAG

Retrieve as FASTA