Entry information : EglPrx66
Entry ID 10888
Creation 2012-05-04 (Qiang Li)
Last sequence changes 2012-05-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-27 (Christophe Dunand)
Peroxidase information: EglPrx66
Name EglPrx66
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx66
start..stop
S start..stop
EgrPrx66 662 0 1..323 1..323
EguPrx66 662 0 1..323 1..323
EcamPrx66-1 661 0 1..323 1..323
EgrPrx65 615 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 687..878 192 N° 3 971..1139 169 N° 4 1219..1610 392
join(1..219,687..878,971..1139,1219..1610)


exon

Literature and cross-references EglPrx66
EST ref. GenBank:   ES595125.1 [5' end]
Protein sequence: EglPrx66
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (297)
PWM (Da):   %s   34612.51 (31758.1) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.93 (9.80) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRHPIWVIVAMAFVTTLGWGSASAQLSTNFYSKSCPNVLSTAKSVVQSAVSKERRMGASLLRLFFHDCFVNGCDGSILLDDTSSFQGEKTAGPNQNSVRGYNVIDQIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASLSRANSGVIPPPTSTLSNLISRFKAQGLSTRDMVALSGSHTIGQARCISFRPRIYNDSNIDSSFSKTRQGKCPRTAGSGDNNLSPLDLQSPTAFDNAYFKNLLSNKGLLHSDQELFNGGTTDSLVKTYSNNPKTFNSDFASAMIKMGDIKPLTGSKGEIRKICSKIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTT
TTGAGCACGGCGAAATCTGTTGTCCAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GTAATCTTTCCTTCCTCCCTC
CCTTTTTCCCAAATTTCTACCTGTTCCCTACATATACTTCCCGGCCACAGCCATTTTTACCATTAAAAACCCGAGTCTTATGTTGTAAACGATGCAAAAGAGCATGCATAATAATTCCAC
TATAAAGGTTGTCTATGACCATTTCTATGAATACACTGGCTTTCTTTCTTTTTGAATAAAAAAAAAAGGCCGATTTGGACATTGAAAAATAATGTGATGGCATTCATGCAAACTGATCTA
CGCATATAGAGTTACTTAAGATGATTTGAAAATTAAGTGACTCAGAGTCCACTACAATGCATAAGGCTTTATCAGCCGTTCAATGTTTAATACGTGTGAACTTCTCTAGGGGGAATCACT
AACTTTTTAGTGGATTATCGATGAATCTGTCACGTTCAAAGACATGCATGGTTTGACATGGTTAGTTTTGCATCGACCAAAAATAGGGGTGCGACGGCTCGATACTCCTGGATGACACAT
CCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTGGTCTCTTGTGCAG
ACATTGTGGCCATTGCTGCTCGCGACTCGGTCGTGCTA
GTATGTATTGAAATTGATATGGCTAGTTGTTCATTTAGTCTGAGCCCCTAAATTGCTGTTATTATCAATTGATGGTGATGTG
ATATTTGAAGCTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCCAACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCTCCAA
CCTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACTAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCCCTGGCCTCGCTCAGTTGCTAGGTTGCTCATGGGTCGTG
CATGGGCGTGCATTGCAGGGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGT
GCCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCTCCTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGG
ACCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCC
TCACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGCAAGATCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTT
TTGAGCACGGCGAAATCTGTTGTCCAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GGGTGCGACGGCTCGATACTC
CTGGATGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTG
GTCTCTTGTGCAGACATTGTGGCCATTGCTGCTCGCGACTCGGTCGTGCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCC
AACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCTCCAACCTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACTAGGGACATGGTTGCCTTGTCTG
GGTCTCACACCATAGGTCAG
GCAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCT
CCTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTC
GTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGC
AAGATCAATTAG

Retrieve as FASTA