Entry information : EglPrx72
Entry ID 10894
Creation 2012-05-04 (Qiang Li)
Last sequence changes 2012-05-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-22 (Christophe Dunand)
Peroxidase information: EglPrx72
Name EglPrx72
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer Cold stress
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx72
start..stop
S start..stop
EguPrx72 666 0 1..327 1..327
EgrPrx72 665 0 1..327 1..327
EcamPrx72 661 0 1..327 1..327
EgrPrx71 597 0 1..327 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..225 225 N° 2 578..763 186 N° 3 994..1159 166 N° 4 1343..1749 407
join(1..225,578..763,994..1159,1343..1749)


exon

Literature and cross-references EglPrx72
EST ref. GenBank:   ES595605.1 [Fragment]
Protein sequence: EglPrx72
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35706.47 (32665.9)  
PI (pH):   %s   8.54 (8.86) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACPKLFLSCLLLELMFFFLVPEVAQGHSIKAGFYGKACPNAEAIVKEVIGQILSVAPSLSGPLLRLHFHDCFVRGCEGSVLLDSPTYQSEKYAFRKHGLRGYQEIDRVKTALEKACPGIVSCADILALVARDIVVATGGLFYDVETGRRDGYVSISEEARRDLIPPTTNITTLKADFAKRGLSAKDLVILSGGHTIGNSHCSPFSNRLYNFTGKGDADPTLDSNYIARLKLSCKPNDQTTLVEMDPGSARTFDIKYFDLILKRRGLFTSDAALLDDNQTKAYLDFQIKTGGSTFFKDFGVSMVKMGRIGVLPKMAGEVRKVCTKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTGAGTTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACAGTATCAAAGCAGGGTTTTACGGGAAGGCATGCCCA
AACGCAGAGGCCATCGTGAAGGAAGTCATTGGCCAAATCTTGTCCGTCGCTCCGAGTCTTTCTGGCCCTCTTTTGAGATTGCATTTTCACGATTGCTTCGTTAGG
GTAAGTAAGAGAGCA
AGCTCCCATACTACTCGTCGTACTACGCGTTTGAAGTTTACCATTTTCTTATAACTTGACTAGTTGCTATAACTAATGTTCGGATAAACAGAGGGTGAGAAGTTAGACCCTGGGCTTTCA
TCTGAAGGGGTAATGCATGGCAGGGATGCGTCGAGATTTACTAAATAGGTTTACCTGATAACAATATGATAAAATGGAAAATGTGTCTTAGAACTAGTAATATACCAGTAAATGGTATTT
GGCTCTCAACATACTTCTCTAGATTCGTCTTTGGTTATGAGCTATTGTTTTCATGAACTCACGGTTGAATGATGCTTTGTTCTGGGTTTTTGCACAGGGCTGTGAAGGTTCGGTACTACT
GGACTCTCCGACCTATCAATCCGAGAAGTACGCCTTTCGAAAGCACGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCGTTGGAGAAGGCATGCCCTGGCATCGTTTCGTG
TGCTGACATCTTGGCCCTTGTCGCCAGAGACATTGTCGTCGCG
GTGTGCCTATTCATAAATCATCTCAATATTTTATTATCAATTTGATTGTTTGTCACACCAGTACTACGTTAGTAGAA
TTCTCAATTTTTATCACACAGTCTACGTTATCACATTGGAAAACAAATTTGAGCCACACGTATCATAAAGGATAGGTACCGATAATTTTTTTAATGAGAAAAACATTTTTATATAGAAAT
TGGGGGTTTTCTTTTTTTGTGCTATCGCTTTAGACCGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTATGTTTCTATTTCGGAGGAGGCACGTAGGGATTTAATACCA
CCGACGACCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGTCTCAGTGCGAAGGACCTCGTTATCCTATCAG
GTAACACCTAATCTCCAATTACTGTTTTACATGCTTGTCAA
ATATATTGGATATATTGACATAAATTCATCTGGTAAAAAATTGTCATTTGAGCGTGAGATACATGAACGCAATCAGTGGTCCAGGGAGAAAATGTAATTTGTAAGGTAAGATCAATGTCG
ATTCTACTTTCCAATTGACCAGGTGGGCACACCATTGGAAATTCACACTGCTCTCCCTTCTCCAACCGCCTCTATAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACTCCAAC
TATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACCACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCTTGAAAAGAAGA
GGGCTCTTCACTTCGGACGCTGCACTTCTAGACGACAACCAAACCAAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCAATGGTGAAA
ATGGGTCGAATTGGCGTGCTCCCCAAAATGGCTGGTGAAGTCAGAAAAGTGTGTACAAAGGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTGAGTTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACAGTATCAAAGCAGGGTTTTACGGGAAGGCATGCCCA
AACGCAGAGGCCATCGTGAAGGAAGTCATTGGCCAAATCTTGTCCGTCGCTCCGAGTCTTTCTGGCCCTCTTTTGAGATTGCATTTTCACGATTGCTTCGTTAGG
GGCTGTGAAGGTTCG
GTACTACTGGACTCTCCGACCTATCAATCCGAGAAGTACGCCTTTCGAAAGCACGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCGTTGGAGAAGGCATGCCCTGGCATC
GTTTCGTGTGCTGACATCTTGGCCCTTGTCGCCAGAGACATTGTCGTCGCG
ACCGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTATGTTTCTATTTCGGAGGAGGCA
CGTAGGGATTTAATACCACCGACGACCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGTCTCAGTGCGAAGGACCTCGTTATCCTATCAG
GTGGGCACACCATTGGAAATTCA
CACTGCTCTCCCTTCTCCAACCGCCTCTATAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACTCCAACTATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACC
ACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCTTGAAAAGAAGAGGGCTCTTCACTTCGGACGCTGCACTTCTAGACGACAACCAAACC
AAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCAATGGTGAAAATGGGTCGAATTGGCGTGCTCCCCAAAATGGCTGGTGAAGTCAGA
AAAGTGTGTACAAAGGTCAATTAA

Retrieve as FASTA