Entry information : EglPrx76
Entry ID 10898
Creation 2012-05-04 (Qiang Li)
Last sequence changes 2012-05-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-21 (Christophe Dunand)
Peroxidase information: EglPrx76
Name EglPrx76
Class Class III peroxidase    [Orthogroup: Prx046]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx76
start..stop
S start..stop
EgrPrx76 681 0 1..329 1..329
EguPrx76 675 0 1..329 1..329
EcamPrx76 630 0 26..329 1..304
PtPrx83 470 2e-168 18..329 27..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..210 210 N° 2 501..692 192 N° 3 886..1051 166 N° 4 1481..1902 422
join(1..210,501..692,886..1051,1481..1902)


exon

Literature and cross-references EglPrx76
Protein sequence: EglPrx76
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (310)
PWM (Da):   %s   36556.16 (34640.1)  
PI (pH):   %s   4.62 (4.62) Peptide Signal:   %s   cut: 20 range:20-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVLLSVLLLLSLYGVGTSGGEGALVLGYYQEKCPLLEEIVRHSVERAVYREPRMAASLLRVHFHDCFVMGCDASVLLDSFDGMVSEKQAVPNLNSLRGFEVIDEIKYNLEEACPYTVSCADILAIVARDAVELRGGPRWEVWLGRRDSLKASFDGANKFIPAPNSSLEALIANFGQQGLDERDLVALSGSHTMGKARCLSFRQGIYEESTERQYDPFQRYTTFYDTLQSICPETGSDNRLASLDHVTPFEFDNHYFLNLLQGTGLLPSDNALINEDHEGVISRLVWTYASDTEAFFRDFANSVVKMGNINVLTESGGEIRRTCRFINT

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGGCTCTCGTTCTTGGGTACTACCAAGAGAAGTGCCCTCTGTTGGAAGAAATCGTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTGTC
CATTTTCACGACTGTTTCGTCATGGATTTACAATATCCTATTGATTTGTGAAGTTGCAGTACTTGAATGTACACAGCAACTAGAAAATGT
CTCATAAATTGACATTAGAGATTTCCATCA
GTTCATCTGCCTAAATAAACCAGAACATGAGACGGTCCCTTTTAACTTTTCGTGGGAAAAGTAATTAGTATTTTCATTTTCCAGCCGCATCTTCTCTATGGGCTAACATCTTGTGTCATT
CTTTTGAGGATTAGAACCTTAACTCCTTGCGTGGGTTCGAGGTGATTGACGAGATAAAGTATAATCTGGAAGAGGCGTGTCCATACACAGTCTCCTGTGCTGATATTTTGGCCATTGTTG
CTCGAGATGCAGTCGAGCTGGTTCACGTCATGTGTCGGTCAATCAAGATTTCTATTTCTGATGGACTCGTTCTTACTCTAAACCTAACCTTTCTCTAGTACGTCCACACTTAGCATCATA
TACACTGAGAAATTTCTTATCTCTGTAAAAAAGAGAGGAGGGCCCAGGTGGGAAGTGTGGCTAGGCAGGAGAGACTCACTCAAGGCAAGCTT
TGATGGAGCCAACAAATTCATACCTGCT
CCAAATTCCTCCCTTGAAGCCCTAATTGCTAATTTCGGGCAACAGGGCCTGGACGAAAGAGACTTGGTTGCCTTATCAGGTAATCCTTTGTTTGTAACTATTCTTGCTAAATCAATAGAT
TCATATCAGTTACTCATATAAAGAAGTTGGCTATGTCATCACATAAAATGTCTCAAAAGTTAAAAACAGCTCGAAACGAATTGCTAATGGTTTCAAGANNNNNNAATAGTTCTCCTAATT
CTTATCCTGAGTACAATTTTTTGATGCCGTGATCTTTTGTACATTTGGCATTTCCTCTATATATTTATTGCTTTTACCAAAAAAAAAAAAG
TTCTCCTAATGTGTTTCAGTACGATGACT
TTCACTTAAGCATACCATCAGTTTCTTCTTCCTCCTTCCATTTGTTCTCAGTTAACACCGTTTTGTACGTCGAAAACTACGGAAGCAGGTAGTCACACGATGGGAAAAGCACGATGCCTG
AGCTTCAGGCAAGGAATTTACGAGGAAAGCACTGAACGACAGTACGATCCCTTCCAGAGATACACCACCTTCTACGATACCCTACAGTCCATATGCCCCGAGACCGGAAGTGATAATAGA
TTAGCATCGCTTGATCACGTGACGCCTTTCGAGTTCGACAACCACTACTTCCTTAACCTCCTCCAAGGCACGGGTCTCCTACCATCTGATAATGCCCTCATCAATGAAGACCATGAAGGT
GTTATTTCGAGGCTTGTCTGGACTTATGCCTCGGATACAGAGGCTTTCTTCCGCGACTTTGCGAACTCGGTTGTGAAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGATC
AGGAGAACATGTCGATTCATCAACACTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGGCTCTCGTTCTTGGGTACTACCAAGAGAAGTGCCCTCTGTTGGAAGAAATCGTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTGTC
CATTTTCACGACTGTTTCGTCATGGATTTACAATATCCTATTGATTTGTGAAGTTGCAGTACTTGAATGTACACAGCAACTAGAAAATGT
GTTCACGTCATGTGTCGGTCAATCAAGATT
TCTATTTCTGATGGACTCGTTCTTACTCTAAACCTAACCTTTCTCTAGTACGTCCACACTTAGCATCATATACACTGAGAAATTTCTTATCTCTGTAAAAAAGAGAGGAGGGCCCAGGTG
GGAAGTGTGGCTAGGCAGGAGAGACTCACTCAAGGCAAGCTT
AAATGTCTCAAAAGTTAAAAACAGCTCGAAACGAATTGCTAATGGTTTCAAGANNNNNNAATAGTTCTCCTAATTCTT
ATCCTGAGTACAATTTTTTGATGCCGTGATCTTTTGTACATTTGGCATTTCCTCTATATATTTATTGCTTTTACCAAAAAAAAAAAAG
AGGCTTTCTTCCGCGACTTTGCGAACTCGGTT
GTGAAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGATCAGGAGAACATGTCGATTCATCAACACTTAA

Retrieve as FASTA