Entry information : OsPrx81 (Os06g33100)
Entry ID 1091
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx81 (Os06g33100)
Name (synonym) OsPrx81 (Os06g33100)
Class Class III peroxidase    [Orthogroup: Prx195]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx81
start..stop
S start..stop
OsPrx82 612 0 1..338 1..338
OsPrx[P]81 486 9e-176 83..328 1..246
OsPrx83 417 2e-147 36..338 33..334
OsPrx85 389 1e-136 6..336 5..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18924459..18924704 246 N° 2 18923597..18924367 771  
complement(join(18923597..18924367,18924459..18924704))


exon

Literature and cross-references OsPrx81 (Os06g33100)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q654F1
DNA ref. GenBank:   NC_008399.1 (18924704..18923600)
Protein sequence: OsPrx81 (Os06g33100)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (311)
PWM (Da):   %s   36887.97 (34259.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.91 (4.75) Peptide Signal:   %s   cut: 28 range:28-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFRCKGGVAWVALLVAVAALASAAQGFPNPFGHEEFTESYYDETCPNAQSIVRSVMERHAAANPRTAPAILRLFFHDCFVNGCDASILLNATDSMESEKDAEPNATLAGFDVIDGIKSELERSCPATVSCADVLALAARDAVAMLGGPSWGVLLGRKDSLTASIDMAKEDLPNPKDSLAELIRMFKEHDLDERDLTALSGAHTVGMAHDCKNYDDRIYSRVGQGGDSIDPSFAALRRQECEQKHDKATAPFDERTPAKFDNAYYVDLLARRGLLTSDQELYTQGCQTGDLVKTYAMNGDVFFADFTRAMVKMGNIRPKHWWTPAEVRLKCSVANTHY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTTAGGTGTAAGGGCGGCGTCGCTTGGGTTGCTCTGCTCGTCGCTGTCGCGGCTCTCGCCTCCGCCGCTCAGGGATTTCCAAATCCCTTCGGTCACGAGGAGTTCACGGAGAGT
TACTACGACGAGACGTGCCCCAACGCGCAGAGCATCGTGCGCTCGGTCATGGAGCGCCACGCCGCCGCCAACCCCCGCACGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTT
GTCAAC
GTAAGTACACCAATCTCTCCATCGTACGAGGAGGCCACCATTAGAAGCATAACGAATGCATTTGTCTAACAATCATCGGTGACATTTGCAGGGTTGTGATGCCTCCATCCTTCT
GAACGCTACGGACTCCATGGAGAGCGAGAAGGATGCCGAGCCCAACGCCACCCTCGCCGGCTTCGACGTGATCGACGGCATCAAGTCCGAGCTCGAGCGCAGCTGCCCGGCCACCGTCTC
CTGCGCCGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCCATGCTCGGTGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCCCTCACCGCCAGCATAGACATGGCCAAAGA
GGATCTCCCGAACCCGAAAGACAGCCTGGCCGAACTCATCAGGATGTTCAAGGAGCACGACCTCGACGAGCGTGACCTCACCGCGCTCTCCGGTGCACACACCGTCGGCATGGCACATGA
CTGCAAGAACTACGACGACCGCATCTACAGTCGCGTCGGCCAGGGCGGCGACAGCATCGACCCATCCTTCGCGGCGCTGCGCAGGCAGGAGTGCGAGCAGAAGCACGACAAGGCCACGGC
ACCGTTCGACGAGCGGACGCCAGCCAAGTTTGACAACGCCTACTACGTCGACCTGCTCGCGAGGCGGGGGCTCCTCACCTCTGACCAGGAGCTCTACACCCAGGGCTGCCAGACCGGCGA
CCTGGTGAAGACGTACGCCATGAACGGCGACGTGTTCTTCGCCGACTTCACAAGAGCGATGGTGAAGATGGGGAACATACGCCCAAAGCATTGGTGGACTCCGGCGGAGGTCAGGCTCAA
GTGCTCGGTGGCCAACACACATTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTTAGGTGTAAGGGCGGCGTCGCTTGGGTTGCTCTGCTCGTCGCTGTCGCGGCTCTCGCCTCCGCCGCTCAGGGATTTCCAAATCCCTTCGGTCACGAGGAGTTCACGGAGAGT
TACTACGACGAGACGTGCCCCAACGCGCAGAGCATCGTGCGCTCGGTCATGGAGCGCCACGCCGCCGCCAACCCCCGCACGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTT
GTCAAC
GGTTGTGATGCCTCCATCCTTCTGAACGCTACGGACTCCATGGAGAGCGAGAAGGATGCCGAGCCCAACGCCACCCTCGCCGGCTTCGACGTGATCGACGGCATCAAGTCCGAG
CTCGAGCGCAGCTGCCCGGCCACCGTCTCCTGCGCCGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCCATGCTCGGTGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCC
CTCACCGCCAGCATAGACATGGCCAAAGAGGATCTCCCGAACCCGAAAGACAGCCTGGCCGAACTCATCAGGATGTTCAAGGAGCACGACCTCGACGAGCGTGACCTCACCGCGCTCTCC
GGTGCACACACCGTCGGCATGGCACATGACTGCAAGAACTACGACGACCGCATCTACAGTCGCGTCGGCCAGGGCGGCGACAGCATCGACCCATCCTTCGCGGCGCTGCGCAGGCAGGAG
TGCGAGCAGAAGCACGACAAGGCCACGGCACCGTTCGACGAGCGGACGCCAGCCAAGTTTGACAACGCCTACTACGTCGACCTGCTCGCGAGGCGGGGGCTCCTCACCTCTGACCAGGAG
CTCTACACCCAGGGCTGCCAGACCGGCGACCTGGTGAAGACGTACGCCATGAACGGCGACGTGTTCTTCGCCGACTTCACAAGAGCGATGGTGAAGATGGGGAACATACGCCCAAAGCAT
TGGTGGACTCCGGCGGAGGTCAGGCTCAAGTGCTCGGTGGCCAACACACATTATTGA

Retrieve as FASTA