Entry information : EglPrx97
Entry ID 10918
Creation 2012-05-04 (Qiang Li)
Last sequence changes 2012-05-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-22 (Christophe Dunand)
Peroxidase information: EglPrx97
Name EglPrx97
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx97
start..stop
S start..stop
EgrPrx97 720 0 1..350 1..350
EcamPrx97 713 0 1..350 1..350
EguPrx97 681 0 1..350 1..350
EcamPrx96 642 0 1..350 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..234 234 N° 2 982..1176 195 N° 3 2390..3010 621  
join(1..234,982..1176,2390..3010)


exon

Literature and cross-references EglPrx97
Protein sequence: EglPrx97
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (324)
PWM (Da):   %s   38256.17 (35563.8)  
PI (pH):   %s   4.85 (4.71) Peptide Signal:   %s   cut: 27 range:27-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRFSSFVLISCLVIASSPVHVSSSAHLVKGLSWSFYEKSCPKVESVIRKHLKKVFEEDIGQAAGLLRVHFHDCFVKGCDGSVLLDGSANEPSEQDAPPNRSLRRTAFKIIDDLSQLVEKKCGQVVSCADIAAIAARDSVFLSGGPEYDVPLGRRDGLTPATENVVVENIPAPTENASEILSALAKKNFDATDVVALSGGHTIGLAHCTAFENRLYPTQDPTMEKTFAHDLKGVCPTTNSTNTTVLDIRSPNRFDNKYFVDLVNRQGLFTSDQDLYEDPTTRDIVTSFAEDQELFFEKFVLAMTKMGQLSVLTGTKGEIRANCSVRNSENPDLLKYVVEEDLESYAELK

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCCGTTTCAGCTCTTTCGTTTTGATTTCTTGTCTCGTGATAGCTTCATCGCCTGTTCATGTCTCGAGCTCTGCTCACTTAGTGAAGGGGCTCTCGTGGTCCTTCTACGAGAAA
AGCTGTCCCAAGGTTGAGTCCGTCATCAGGAAACATCTCAAGAAGGTGTTTGAGGAGGACATTGGCCAAGCTGCCGGGCTACTTCGTGTGCACTTCCATGACTGCTTTGTTAAG
GTAGGT
ACCCAAGGAGCTCTGTCACAATCTGCATTCACTATACCGGACAAAGTGATTTGGGATTTACTTGAAAGTTATATCTTGATTTGCTCGTCACATGTCCTTATATATGGTGGTCAGCTGATG
TTAAAATGTTTACACACCCTTTTGGCAAGATCTGTGATCATCTTCTTCCCCAGCAAAATAGACGAGAATAAGAAAAGACGGAGAGGCCAAAGAAAAAAAAAAGTTCTTGTCGAGTTGGTG
GCCTAGGTTAGCAGCTGCAATAAGTGAACTTCTTTCCTTTTGATATTGCTAATTTTTAGAATGCTGGGTAGATTACGAAGTCATACGGGCGCCTAAAGCCATCACGACTTTGTCTTTTAG
CATACTAATCTTACTGTCTTACTAGTAAACACTTGCTGAAGTTTTGGAGGATGCTTTTTGAGCGTTTGACATAGTTGATCCTGATCTTTAGTGCTTTATATGCTAAAATGAAGAGCATAG
AAGTTCATAGAACTCCCATGTTCAGGTTTTAGACAGAACTGCTGTAATAATTCTGGTAAATTGTCTTCATAAGATGATTGTACGAGCAGTCCAGTTAAGCCCGGATTGTGTGTGGCGAGG
ATTTTTTTGCTTTGAAGGTTAGGATGGGTTTAAGTCATCACGGTTTCTTTTACAATTGAATCTTGATCACTTACATTAAAATAAATGATAAAACATTCTTTGAATTCACGATTATTTTTT
AAGATCTGATGAGTGATGCAGGGATGCGATGGTTCGGTGTTGCTGGATGGATCGGCAAATGAACCGAGCGAGCAGGACGCTCCACCAAACAGGAGCTTGAGACGGACAGCATTCAAGATC
ATTGATGACCTCAGTCAGCTCGTGGAGAAGAAATGTGGTCAAGTAGTCTCTTGTGCCGACATTGCCGCCATTGCCGCTCGTGATTCCGTTTTCCTG
GTAAACCCCCTTCAGCCATCATTC
CATCATCACTAGAGAGTAACTCACCAAAACAGAGTTCTGATTATGATACTCGCCAGATTCTGATTATCATACTATCGGAAATTTGATAGAAGTACAGATTCTTGCCGAACATGCTTATCC
CTATAAATCATACTAATTTGCAGCTTTGAATGACGCTTTTGCATTTGGTAATGGGAAGGCAAATATGATCATAAGCTTTCAAAATAGAGCAACAGCAGAATACAGTATTGGTCAGTTAGC
TAGCTTCCTAGATAATTGTAATAGTTCTTATGTTCAAGTTGATAAATGGATTTCTATTTAGGGATTAATTGGATTATCGAACTAACCAAACATATAGTAAGTTACACGTTCACACAGAAC
TTTCACTGATTGGATGTTCCCCCTCCGTTAAACATTCAACCACTCCCCATTAATCTGCTGTTTTTGGAAATCAAGTTGATGTATAAAATACCCCAAGTGTGACAGACAATAGTTGTTTAA
CCACTCTTGTTTAGGCTCAGGCTTGATTATACTCATTAAGAGGAATTAGAAATCACGAGAAAGTGGACTCGCTGATGTAACCAAGCGTGGTTAAACTATATTTGGATTCTTGTAGTTTCC
TCCTGTTCGTGTTCTGAATGTTTTGTGAGATGTAGCGGATGTCCATTTAAGTCGGCAGCATTATCTTGGAAACTCAGGACAATTAAACCTGTCATTATGAGCCAAAAAGTTCAGTATACA
GCAAATTTCAATGGTCAAAACTGAGACATCGTCGTTGTTTATATCTGAGTTTTAACCGGTAGTTATCACCATTTTTTTAAGATCCCAACCAGTCGGAGGTTTATTCTGAATTTTGGGATC
ATGATTATGGATAAAATACTGCAACTTGACATGTCTTTGGACTCTTTCAACATGGTCAGGTAAGCATGTGCTTCCAAAGTTCTTGGAAATTGCAGTTGAAATGACAACCTAGGTAGACGA
TTCTGTTTAATGATAATCTACTCCCAACTAGCTTCTAGTTTATGAGAGTTGACTTGCAAATGATCACCTCCACACGAAGAAGACATCAAAGTTCTCCGCTGGCTTCATGTCCTATACATG
ATCGAAGTTTTCTCGATTATGATTACTATTGCCCATCATATCAATGAGCATCAACAGATGATTTCCAAGTTCTGGATTCTAATTCTGTTATTCTCGTCGTCGTGTGCAGTCGGGCGGACC
TGAGTATGATGTGCCGTTGGGAAGGCGGGATGGACTTACGCCTGCGACTGAAAATGTGGTCGTAGAGAATATACCTGCACCAACTGAGAACGCCAGTGAAATTCTCTCCGCCCTAGCCAA
GAAAAACTTCGACGCTACCGACGTAGTGGCCCTCTCTGGAGGCCACACCATTGGGCTTGCGCACTGCACCGCCTTTGAGAATCGGCTCTACCCGACCCAAGACCCCACCATGGAGAAGAC
CTTTGCCCATGATCTCAAGGGCGTGTGCCCCACCACAAACTCCACCAACACTACGGTCTTGGACATCCGATCACCCAACCGATTCGACAACAAGTACTTTGTCGATTTGGTGAACCGCCA
AGGCCTGTTCACCTCAGACCAAGATCTGTATGAGGATCCCACAACGAGGGACATCGTCACTAGCTTCGCCGAGGACCAGGAATTGTTCTTCGAGAAGTTTGTCCTAGCTATGACGAAAAT
GGGACAACTCAGTGTGTTGACAGGGACGAAAGGAGAAATCCGAGCCAACTGCTCGGTCAGGAATTCTGAGAACCCCGATCTCTTGAAGTACGTGGTGGAAGAGGACCTGGAGAGCTATGC
TGAATTGAAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCCGTTTCAGCTCTTTCGTTTTGATTTCTTGTCTCGTGATAGCTTCATCGCCTGTTCATGTCTCGAGCTCTGCTCACTTAGTGAAGGGGCTCTCGTGGTCCTTCTACGAGAAA
AGCTGTCCCAAGGTTGAGTCCGTCATCAGGAAACATCTCAAGAAGGTGTTTGAGGAGGACATTGGCCAAGCTGCCGGGCTACTTCGTGTGCACTTCCATGACTGCTTTGTTAAG
GGATGC
GATGGTTCGGTGTTGCTGGATGGATCGGCAAATGAACCGAGCGAGCAGGACGCTCCACCAAACAGGAGCTTGAGACGGACAGCATTCAAGATCATTGATGACCTCAGTCAGCTCGTGGAG
AAGAAATGTGGTCAAGTAGTCTCTTGTGCCGACATTGCCGCCATTGCCGCTCGTGATTCCGTTTTCCTG
TCGGGCGGACCTGAGTATGATGTGCCGTTGGGAAGGCGGGATGGACTTACG
CCTGCGACTGAAAATGTGGTCGTAGAGAATATACCTGCACCAACTGAGAACGCCAGTGAAATTCTCTCCGCCCTAGCCAAGAAAAACTTCGACGCTACCGACGTAGTGGCCCTCTCTGGA
GGCCACACCATTGGGCTTGCGCACTGCACCGCCTTTGAGAATCGGCTCTACCCGACCCAAGACCCCACCATGGAGAAGACCTTTGCCCATGATCTCAAGGGCGTGTGCCCCACCACAAAC
TCCACCAACACTACGGTCTTGGACATCCGATCACCCAACCGATTCGACAACAAGTACTTTGTCGATTTGGTGAACCGCCAAGGCCTGTTCACCTCAGACCAAGATCTGTATGAGGATCCC
ACAACGAGGGACATCGTCACTAGCTTCGCCGAGGACCAGGAATTGTTCTTCGAGAAGTTTGTCCTAGCTATGACGAAAATGGGACAACTCAGTGTGTTGACAGGGACGAAAGGAGAAATC
CGAGCCAACTGCTCGGTCAGGAATTCTGAGAACCCCGATCTCTTGAAGTACGTGGTGGAAGAGGACCTGGAGAGCTATGCTGAATTGAAA

Retrieve as FASTA