Entry information : OsPrx82 (Os06g33080)
Entry ID 1092
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx82 (Os06g33080)
Name (synonym) OsPrx82 (Os06g33080)
Class Class III peroxidase    [Orthogroup: Prx195]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx82
start..stop
S start..stop
OsPrx81 612 0 1..338 1..338
OsPrx[P]81 464 5e-167 83..328 1..246
OsPrx83 412 1e-145 36..338 33..334
OsPrx85 380 7e-133 6..336 5..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18911311..18911556 246 N° 2 18910447..18911217 771  
complement(join(18910447..18911217,18911311..18911556))


exon

Literature and cross-references OsPrx82 (Os06g33080)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q654F7
DNA ref. GenBank:   NC_008399.1 (18911556..18910450)
Protein sequence: OsPrx82 (Os06g33080)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (311)
PWM (Da):   %s   36972.02 (34359.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.12 (4.90) Peptide Signal:   %s   cut: 28 range:28-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFRCKGGVAWVALLVAVAALASAAQGFPNPFGHEEFTESYYDETCPNAQSIVRSVMERHAAANPRTAPAILRLFFHDCFVNGCDASILLNATDSMESEKDAKPNASVVGYDVIEDIKSELERSCPATVSCADVLALAARDAVAMLGGPSWGVLLGRKDSLAARMDMANKDLPRPTDSLAELIRMFKENNLDERDLTALSGAHTVGRTHSCEHYEERIYSLVGQGGDSIDPSFAAQRRQECEQKHGNATAPFDERTPAKFDNAYYVDLLARRGLLTSDQELYTQGCETGDLVKTYAMNGDVFFADFARAMVKMGNIRPKHWWTPTEVRLKCSVANTHY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTAGGTGTAAGGGCGGCGTCGCTTGGGTTGCTCTGCTCGTCGCTGTCGCGGCTCTCGCCTCCGCCGCTCAGGGATTTCCAAATCCCTTCGGTCACGAGGAGTTCACGGAGAGT
TACTACGACGAGACGTGCCCCAACGCGCAGAGCATCGTGCGCTCGGTCATGGAGCGCCACGCCGCCGCCAACCCCCGCACGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTC
GTCAAC
GTAAGTACACCACAATCTCTCGATCGTACGAGGAGGCCACCATTAGAGCATCACGAAATGCATTTGTCTAACAATCATCGGTGACATTTGCAGGGTTGTGATGCCTCCATCCTT
CTGAACGCTACGGACTCCATGGAGAGCGAGAAGGACGCCAAGCCCAACGCCTCCGTCGTCGGCTACGACGTGATCGAAGACATCAAGTCGGAACTCGAGCGCAGCTGCCCGGCCACCGTC
TCCTGCGCTGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCCATGCTCGGCGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCCCTCGCCGCCCGCATGGACATGGCCAAC
AAGGATCTCCCGAGACCGACAGACAGCCTAGCCGAGCTCATCAGGATGTTCAAGGAGAACAACCTCGACGAGCGCGACCTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAGGACGCAC
AGCTGCGAGCACTACGAGGAACGCATCTACAGCCTCGTTGGCCAGGGCGGCGACAGCATCGACCCCTCATTCGCGGCGCAACGCAGGCAGGAGTGCGAGCAGAAGCACGGCAACGCCACG
GCGCCGTTCGATGAGCGGACGCCAGCCAAGTTCGACAACGCCTACTACGTCGACTTGCTTGCGAGGCGCGGGCTCCTCACATCCGACCAGGAGCTCTACACCCAGGGGTGCGAGACCGGC
GACCTGGTGAAGACGTACGCCATGAACGGCGATGTGTTCTTCGCCGACTTCGCGAGGGCCATGGTTAAGATGGGGAACATACGGCCGAAGCATTGGTGGACTCCGACGGAGGTCAGGCTC
AAGTGCTCGGTGGCCAACACCCATTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTAGGTGTAAGGGCGGCGTCGCTTGGGTTGCTCTGCTCGTCGCTGTCGCGGCTCTCGCCTCCGCCGCTCAGGGATTTCCAAATCCCTTCGGTCACGAGGAGTTCACGGAGAGT
TACTACGACGAGACGTGCCCCAACGCGCAGAGCATCGTGCGCTCGGTCATGGAGCGCCACGCCGCCGCCAACCCCCGCACGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTC
GTCAAC
GGTTGTGATGCCTCCATCCTTCTGAACGCTACGGACTCCATGGAGAGCGAGAAGGACGCCAAGCCCAACGCCTCCGTCGTCGGCTACGACGTGATCGAAGACATCAAGTCGGAA
CTCGAGCGCAGCTGCCCGGCCACCGTCTCCTGCGCTGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCCATGCTCGGCGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCC
CTCGCCGCCCGCATGGACATGGCCAACAAGGATCTCCCGAGACCGACAGACAGCCTAGCCGAGCTCATCAGGATGTTCAAGGAGAACAACCTCGACGAGCGCGACCTCACCGCGCTCTCC
GGCGCGCACACCGTCGGCAGGACGCACAGCTGCGAGCACTACGAGGAACGCATCTACAGCCTCGTTGGCCAGGGCGGCGACAGCATCGACCCCTCATTCGCGGCGCAACGCAGGCAGGAG
TGCGAGCAGAAGCACGGCAACGCCACGGCGCCGTTCGATGAGCGGACGCCAGCCAAGTTCGACAACGCCTACTACGTCGACTTGCTTGCGAGGCGCGGGCTCCTCACATCCGACCAGGAG
CTCTACACCCAGGGGTGCGAGACCGGCGACCTGGTGAAGACGTACGCCATGAACGGCGATGTGTTCTTCGCCGACTTCGCGAGGGCCATGGTTAAGATGGGGAACATACGGCCGAAGCAT
TGGTGGACTCCGACGGAGGTCAGGCTCAAGTGCTCGGTGGCCAACACCCATTATTGA

Retrieve as FASTA