Entry information : EglPrx[P]103
Entry ID 10924
Creation 2012-05-14 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2016-03-12 (Christophe Dunand)
Peroxidase information: EglPrx[P]103
Name EglPrx[P]103
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx[P]103
start..stop
S start..stop
EgrPrx[P]103 120 4e-38 1..64 4..83
EguPrx[P]103 116 1e-36 1..64 4..83
EcamPrx[P]104 57 0.0000000000004 6..34 1..29
CroPrx17 54 0.00000000006 1..34 258..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..101 101 N° 2 150..240 91  
join(1..101,150..240)


exon

Literature and cross-references EglPrx[P]103
Protein sequence: EglPrx[P]103
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   64
PWM (Da):   %s   7052.7  
PI (pH):   %s   8.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
YHLLLNGEGLLISDQELYSSGLAIQTKKIAVQYAxIAESCVIKTRLIFNLCWFFIQSRTYANSS

Retrieve as FASTA  
Remarks Pseudogene sequence from NGS. Short PS due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TACCACTTGCTTTTGAATGGAGAGGGATTACTCATCTCCGACCAAGAACTGTATTCAAGTGGATTGGCGATTCAGACCAAGAAGATTGCGGTACAGTATGCGCATGANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCGCTGAGTCATGTGTAATAAAGACTCGTTTGATTTTTAATCTTTGTTGGTTTTTTATCCAGAGTCGGACATATGCAAACTCGAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TACCACTTGCTTTTGAATGGAGAGGGATTACTCATCTCCGACCAAGAACTGTATTCAAGTGGATTGGCGATTCAGACCAAGAAGATTGCGGTACAGTATGCNNNGATCGCTGAGTCATGT
GTAATAAAGACTCGTTTGATTTTTAATCTTTGTTGGTTTTTTATCCAGAGTCGGACATATGCAAACTCGAGC

Retrieve as FASTA