Entry information : EglPrx[P]104
Entry ID 10925
Creation 2012-05-14 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2016-04-13 (Christophe Dunand)
Peroxidase information: EglPrx[P]104
Name EglPrx[P]104
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx[P]104
start..stop
S start..stop
EcamPrx[P]104 105 2e-32 9..65 1..69
EgrPrx[P]104 98 2e-29 1..65 1..77
EcamPrx60 102 9e-29 1..65 263..339
MePrx12 102 1e-28 1..65 264..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..110 110 N° 2 147..231 85  
join(1..110,147..231)


exon

Literature and cross-references EglPrx[P]104
Protein sequence: EglPrx[P]104
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   65
PWM (Da):   %s   7085.61  
PI (pH):   %s   8.46
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
NSYYNLLLNGEGLLISDQELYSSVLAIQTKKIAVQYAxMVKMGNITNSDSFVNGEVRKNCRFINT

Retrieve as FASTA  
Remarks Pseudogene sequence from NGS. 5' and PS are missing due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AACTCCTACTACAACTTGCTCTTGAATGGAGAGGGATTACTCATCTCCGACCAAGAACTGTATTCAAGTGTATTGGCGATTCAGACCAAGAAGATTGCGGTACAGTATGCGCATGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTCAAGATGGGGAACATCACGAATTCGGATAGCTTTGTCAATGGAGAAGTGAGGAAGAACTGCAGATTTATCAATACA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AACTCCTACTACAACTTGCTCTTGAATGGAGAGGGATTACTCATCTCCGACCAAGAACTGTATTCAAGTGTATTGGCGATTCAGACCAAGAAGATTGCGGTACAGTATGCNNNNATGGTC
AAGATGGGGAACATCACGAATTCGGATAGCTTTGTCAATGGAGAAGTGAGGAAGAACTGCAGATTTATCAATACA

Retrieve as FASTA