Entry information : OsPrx83
Entry ID 1093
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx83
Name OsPrx83
Class Class III peroxidase    [Orthogroup: Prx195]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx83
start..stop
S start..stop
OsPrx81 419 4e-148 33..334 36..338
OsPrx82 414 5e-146 33..334 36..338
OsPrx85 372 6e-130 1..331 1..321
OsPrx84 358 4e-124 32..331 36..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18858909..18859145 237 N° 2 18857970..18858737 768  
complement(join(18857970..18858737,18858909..18859145))


exon

Literature and cross-references OsPrx83
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z9B2
DNA ref. GenBank:   NC_008399.1 (18859145..18857973)
Protein sequence: OsPrx83
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (307)
PWM (Da):   %s   36182.65 (33683.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.49 (4.45) Peptide Signal:   %s   cut: 28 range:28-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSSRAVVAVASVALLVAALASTAAAEGNPVEYTESYYDNTCPNAQNIVRSVMERSVAANPRMAPAILRLFFHDCFVNGCDGSLLLDSTDSTESEKEEKANASLAGFDVIDAIKSELERSCPATVSCADVLALASRDAVAMLGGPSWGVLLGRKDSRFVTKNATEELPDPRNGHLDVLLGVFREHGLDERDLTALSGAHTVGKAHSCDNFEGRIDGGEGYDDIDPSYAAELRRTCQRPDNCEEAGVPFDERTPMKFDMLYYQDLLFKRGLLATDQALYTPGSWAGELVLTYSRNQEAFFADFARAMVKMGNIRPDPWTPTEVRIKCSVANGHY*

Retrieve as FASTA  
Remarks chromosome 6. 4 ESTs. Rice blast fungus interaction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTAGCTCTAGGGCCGTCGTCGCCGTCGCTTCGGTTGCTCTGCTCGTCGCGGCTCTGGCCTCCACCGCCGCAGCCGAGGGCAATCCCGTCGAGTACACGGAGAGTTACTACGAT
AACACGTGCCCCAACGCGCAGAACATCGTGCGATCGGTGATGGAGCGGAGCGTCGCCGCCAACCCGAGGATGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAT
GTA
AGTATTACCTTCGTTTATTTAGTATGATGCTAGTTACTTACTAAAAAATATTATTATTATTATTAATTTTGTTATGATTTCTTTTACATTAAAGATTCTTTAATAATTACTTCTATTTCA
TGGAATGCATTTGTCTCACAATCATCGGTCACATGGATATATATGCAGGGTTGTGATGGCTCCCTCCTCCTGGACAGTACGGATTCCACGGAGAGCGAGAAGGAGGAAAAAGCCAACGCC
TCCCTCGCCGGCTTCGACGTGATCGACGCCATCAAGTCCGAGCTCGAGCGCAGCTGCCCGGCCACCGTCTCCTGCGCCGACGTCCTCGCGCTCGCCTCCCGCGACGCCGTCGCCATGCTC
GGCGGGCCCAGCTGGGGCGTGCTGCTCGGCCGCAAGGACTCGCGCTTCGTTACCAAGAACGCCACGGAGGAGCTCCCGGACCCGAGAAACGGCCACCTCGACGTCCTCCTCGGGGTGTTC
CGCGAGCACGGCCTCGACGAACGCGACCTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAAGGCCCACAGCTGCGACAACTTCGAGGGCCGCATCGACGGCGGCGAGGGCTACGACGAC
ATCGACCCGTCCTACGCGGCGGAGCTCCGTCGGACGTGCCAGCGGCCGGACAACTGCGAGGAGGCCGGCGTGCCGTTCGACGAGCGGACGCCGATGAAGTTCGACATGCTCTACTACCAG
GACCTGCTCTTCAAGCGGGGGCTCCTCGCCACCGACCAGGCGCTCTACACCCCGGGCAGCTGGGCCGGCGAGCTTGTGCTGACCTACTCCCGCAACCAGGAGGCGTTCTTCGCCGACTTC
GCGAGGGCGATGGTGAAGATGGGGAACATACGCCCGGACCCTTGGACTCCGACGGAGGTCAGGATCAAGTGCTCCGTGGCCAATGGTCATTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTAGCTCTAGGGCCGTCGTCGCCGTCGCTTCGGTTGCTCTGCTCGTCGCGGCTCTGGCCTCCACCGCCGCAGCCGAGGGCAATCCCGTCGAGTACACGGAGAGTTACTACGAT
AACACGTGCCCCAACGCGCAGAACATCGTGCGATCGGTGATGGAGCGGAGCGTCGCCGCCAACCCGAGGATGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAT
GGT
TGTGATGGCTCCCTCCTCCTGGACAGTACGGATTCCACGGAGAGCGAGAAGGAGGAAAAAGCCAACGCCTCCCTCGCCGGCTTCGACGTGATCGACGCCATCAAGTCCGAGCTCGAGCGC
AGCTGCCCGGCCACCGTCTCCTGCGCCGACGTCCTCGCGCTCGCCTCCCGCGACGCCGTCGCCATGCTCGGCGGGCCCAGCTGGGGCGTGCTGCTCGGCCGCAAGGACTCGCGCTTCGTT
ACCAAGAACGCCACGGAGGAGCTCCCGGACCCGAGAAACGGCCACCTCGACGTCCTCCTCGGGGTGTTCCGCGAGCACGGCCTCGACGAACGCGACCTCACCGCGCTCTCCGGCGCGCAC
ACCGTCGGCAAGGCCCACAGCTGCGACAACTTCGAGGGCCGCATCGACGGCGGCGAGGGCTACGACGACATCGACCCGTCCTACGCGGCGGAGCTCCGTCGGACGTGCCAGCGGCCGGAC
AACTGCGAGGAGGCCGGCGTGCCGTTCGACGAGCGGACGCCGATGAAGTTCGACATGCTCTACTACCAGGACCTGCTCTTCAAGCGGGGGCTCCTCGCCACCGACCAGGCGCTCTACACC
CCGGGCAGCTGGGCCGGCGAGCTTGTGCTGACCTACTCCCGCAACCAGGAGGCGTTCTTCGCCGACTTCGCGAGGGCGATGGTGAAGATGGGGAACATACGCCCGGACCCTTGGACTCCG
ACGGAGGTCAGGATCAAGTGCTCCGTGGCCAATGGTCATTATTGA

Retrieve as FASTA