Entry information : OsPrx84 (Os06g32980)
Entry ID 1094
Creation 2008-09-02 (Christophe Dunand)
Last sequence changes 2008-09-02 (Christophe Dunand)
Sequence status complete
Reviewer Michele Oliva
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx84 (Os06g32980)
Name (synonym) OsPrx84 (Os06g32980)
Class Class III peroxidase    [Orthogroup: Prx079]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx84
start..stop
S start..stop
OsPrx85 546 0 1..329 1..322
TaPrx28 379 1e-132 37..329 28..323
BdiPrx26 379 2e-132 37..329 28..322
OsPrx81 377 1e-131 37..329 36..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18852659..18852895 237 N° 2 18851809..18852561 753  
complement(join(18851809..18852561,18852659..18852895))


exon

Literature and cross-references OsPrx84 (Os06g32980)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z9B3
DNA ref. GenBank:   NC_008399.1 (18852895..18851812)
mRNA ref. GenBank:   NM_001064280.1
Cluster/Prediction ref. UniGene:   Os.80455
Protein sequence: OsPrx84 (Os06g32980)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   36219.88 (33740.5)  
PI (pH):   %s   5.6 (5.59) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGISKSFFVASLSLLLAVLASTGEGSHQPVVMPVAMELSAKYYRKTCPNVQNAVRTVMEHRLDMAPAVLRLFFHDCFVNGCDASVLLNRTDTMESEKDAEPANTSLAGFDVIDEIKSVLEHDCPATVSCADILALASRDAVALLGGPRWSVPLGRMDSRQASKAVAEDANNLPNPNSDLGELLRVFETHGLDARDFTALSGAHTVGKAHSCDNYRDRVYGDHNIDPSFAALRRRSCEQGRGEAPFDEQTPMRFDNKYYQDLLHRRGLLTSDQELYTHGGEVTSELVELYAKSRKAFFADFARAMVKMGEIRPPEWIPVEVRLNCGMVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, intron 1) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATCTCGAAGAGTTTCTTCGTCGCTTCGCTTTCTCTGCTCCTCGCGGTTCTCGCGTCCACCGGCGAGGGAAGCCACCAGCCGGTCGTAATGCCGGTGGCGATGGAGCTGTCTGCC
AAGTACTACAGGAAGACGTGCCCCAACGTGCAGAACGCCGTGCGCACGGTGATGGAGCACAGGCTGGACATGGCGCCGGCCGTCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GTA
AGTATATGTACTAGTCTCGTACTGCACGACACCCCATATGAGAGGAGAATGCACAAATGCTTTTGTGTCTCACAATCATCCATGACACATTTAGGGTTGTGACGCCTCTGTTCTTCTGAA
CCGGACGGACACCATGGAGAGCGAGAAGGACGCCGAGCCGGCCAACACCTCGCTCGCCGGGTTCGACGTCATCGACGAGATCAAGTCGGTGCTGGAGCACGACTGCCCGGCCACCGTCTC
CTGCGCCGACATCCTCGCGCTCGCCTCCCGCGACGCCGTCGCCCTCCTCGGCGGGCCGAGATGGAGCGTGCCGCTCGGCCGCATGGACTCGCGGCAAGCCAGCAAAGCGGTCGCCGAGGA
CGCCAACAACCTCCCGAACCCGAACAGCGATCTCGGCGAGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACTTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAAGGC
CCACAGCTGCGACAACTACAGGGACCGCGTCTATGGCGACCACAATATCGACCCCTCATTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCAGAGGCGAGGCGCCGTTCGACGAGCA
GACGCCGATGAGGTTCGACAACAAATACTACCAGGACCTGCTCCATCGGCGCGGGCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAGGTAACTAGTGAGCTTGTGGAGCT
GTACGCGAAGAGCCGTAAGGCGTTCTTCGCGGACTTCGCGAGGGCGATGGTGAAGATGGGGGAGATACGCCCGCCGGAGTGGATTCCGGTGGAGGTGAGGCTCAACTGCGGGATGGTCAA
CAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATCTCGAAGAGTTTCTTCGTCGCTTCGCTTTCTCTGCTCCTCGCGGTTCTCGCGTCCACCGGCGAGGGAAGCCACCAGCCGGTCGTAATGCCGGTGGCGATGGAGCTGTCTGCC
AAGTACTACAGGAAGACGTGCCCCAACGTGCAGAACGCCGTGCGCACGGTGATGGAGCACAGGCTGGACATGGCGCCGGCCGTCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GGT
TGTGACGCCTCTGTTCTTCTGAACCGGACGGACACCATGGAGAGCGAGAAGGACGCCGAGCCGGCCAACACCTCGCTCGCCGGGTTCGACGTCATCGACGAGATCAAGTCGGTGCTGGAG
CACGACTGCCCGGCCACCGTCTCCTGCGCCGACATCCTCGCGCTCGCCTCCCGCGACGCCGTCGCCCTCCTCGGCGGGCCGAGATGGAGCGTGCCGCTCGGCCGCATGGACTCGCGGCAA
GCCAGCAAAGCGGTCGCCGAGGACGCCAACAACCTCCCGAACCCGAACAGCGATCTCGGCGAGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACTTCACCGCGCTCTCC
GGCGCGCACACCGTCGGCAAGGCCCACAGCTGCGACAACTACAGGGACCGCGTCTATGGCGACCACAATATCGACCCCTCATTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCAGA
GGCGAGGCGCCGTTCGACGAGCAGACGCCGATGAGGTTCGACAACAAATACTACCAGGACCTGCTCCATCGGCGCGGGCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAG
GTAACTAGTGAGCTTGTGGAGCTGTACGCGAAGAGCCGTAAGGCGTTCTTCGCGGACTTCGCGAGGGCGATGGTGAAGATGGGGGAGATACGCCCGCCGGAGTGGATTCCGGTGGAGGTG
AGGCTCAACTGCGGGATGGTCAACAATTGA

Retrieve as FASTA