Entry information : OsPrx85 (Os06g32960)
Entry ID 1095
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx85 (Os06g32960)
Name (synonym) OsPrx85 (Os06g32960)
Class Class III peroxidase    [Orthogroup: Prx079]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx85
start..stop
S start..stop
OsPrx84 534 0 29..322 37..329
TaPrx28 390 6e-137 29..322 28..323
BdiPrx27 388 4e-136 12..321 9..325
OsPrx81 385 4e-135 29..322 36..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18846638..18846850 213 N° 2 18846934..18847689 756  
join(18846638..18846850,18846934..18847689)


exon

Literature and cross-references OsPrx85 (Os06g32960)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z9B5
DNA ref. GenBank:   NC_008399.1 (18846638..18847686)
Protein sequence: OsPrx85 (Os06g32960)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (299)
PWM (Da):   %s   35595.36 (33184.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   4.68 (4.62) Peptide Signal:   %s   cut: 24 range:24-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSKGLFVASFTLFLLVALAFADESRPELSPAYYKKTCPNLENAVRTVMSQRMDMAPAILRLFFHDCFVNGCDASVLLDRTDSMEREKDAEPANTSLAGFDVIDEIKSVLEHDCPATVSCADILGLASRDAVALLGGPSWSVPLGRMDSRRASKDDAESVDNLPNPNSDLGELLRVFETHGLDARDLTALSGAHTVGKAHSCDNYRDRIYGANNDNIDPSFAALRRRSCEQGGGEAPFDEQTPMRFDNKYFQDLLQRRGLLTSDQELYTHGGEVSDLVEMYATNREAFFADFARAMVKMGNIRPPQWMPLEVRLNCRMVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGTCCAAGGGTCTCTTCGTCGCTTCGTTTACGCTATTTCTCCTCGTGGCTCTGGCGTTCGCCGACGAGAGCAGGCCGGAGCTCTCACCGGCGTACTACAAGAAGACGTGCCCC
AACCTGGAGAACGCCGTGCGCACGGTGATGTCGCAGAGGATGGACATGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GTAAGTAGTATATCACTCTCTCATAGT
AGGTAGGAGGACGCCATTACGAGTGCTTTTATCTCACAATATTCGATGGCATGCAGGGATGTGATGCCTCTGTTCTTCTTGACCGGACGGACTCCATGGAGAGAGAGAAAGACGCCGAGC
CGGCCAACACCTCGCTCGCCGGATTCGACGTCATCGACGAGATCAAGTCGGTGCTCGAGCACGACTGCCCGGCCACCGTCTCCTGCGCCGACATCCTCGGGCTCGCCTCCCGCGACGCCG
TCGCCCTCCTCGGCGGGCCCAGCTGGAGCGTGCCGCTCGGCCGCATGGACTCGCGCCGAGCCAGCAAAGACGACGCCGAGAGCGTCGACAACCTCCCGAACCCGAACAGCGATCTCGGCG
AGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACCTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAAGGCCCACAGCTGCGACAACTACAGGGACCGCATCTACGGCG
CCAACAACGACAACATCGACCCCTCCTTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCGGCGGCGAGGCGCCGTTCGACGAGCAGACGCCGATGCGGTTCGACAACAAGTACTTCC
AGGACTTGCTCCAGCGGCGCGGCCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAGGTAAGCGACCTGGTGGAGATGTACGCGACGAACCGCGAGGCGTTCTTCGCGGACT
TCGCGAGGGCGATGGTGAAGATGGGGAACATACGCCCGCCGCAGTGGATGCCACTGGAGGTGAGGCTCAACTGCAGGATGGTCAACAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGTCCAAGGGTCTCTTCGTCGCTTCGTTTACGCTATTTCTCCTCGTGGCTCTGGCGTTCGCCGACGAGAGCAGGCCGGAGCTCTCACCGGCGTACTACAAGAAGACGTGCCCC
AACCTGGAGAACGCCGTGCGCACGGTGATGTCGCAGAGGATGGACATGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GGATGTGATGCCTCTGTTCTTCTTGAC
CGGACGGACTCCATGGAGAGAGAGAAAGACGCCGAGCCGGCCAACACCTCGCTCGCCGGATTCGACGTCATCGACGAGATCAAGTCGGTGCTCGAGCACGACTGCCCGGCCACCGTCTCC
TGCGCCGACATCCTCGGGCTCGCCTCCCGCGACGCCGTCGCCCTCCTCGGCGGGCCCAGCTGGAGCGTGCCGCTCGGCCGCATGGACTCGCGCCGAGCCAGCAAAGACGACGCCGAGAGC
GTCGACAACCTCCCGAACCCGAACAGCGATCTCGGCGAGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACCTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAAGGCC
CACAGCTGCGACAACTACAGGGACCGCATCTACGGCGCCAACAACGACAACATCGACCCCTCCTTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCGGCGGCGAGGCGCCGTTCGAC
GAGCAGACGCCGATGCGGTTCGACAACAAGTACTTCCAGGACTTGCTCCAGCGGCGCGGCCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAGGTAAGCGACCTGGTGGAG
ATGTACGCGACGAACCGCGAGGCGTTCTTCGCGGACTTCGCGAGGGCGATGGTGAAGATGGGGAACATACGCCCGCCGCAGTGGATGCCACTGGAGGTGAGGCTCAACTGCAGGATGGTC
AACAATTGA

Retrieve as FASTA