Entry information : OsPrx86
Entry ID 1096
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx86
Name OsPrx86
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Leaves
Roots
Shoots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx86
start..stop
S start..stop
SbPrx138 562 0 25..324 26..325
SiPrx33 558 0 28..324 29..325
TaPrx32 552 0 15..324 14..322
BdiPrx23 533 0 4..324 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20358787..20359017 231 N° 2 20358478..20358669 192 N° 3 20357830..20358381 552  
complement(join(20357830..20358381,20358478..20358669,20358787..20359017))


exon

Literature and cross-references OsPrx86
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z7J2
DNA ref. GenBank:   NC_008399.1 (20359017..20357833)
Protein sequence: OsPrx86
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (295)
PWM (Da):   %s   33927.9 (31298.4) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.21 (8.21) Peptide Signal:   %s   cut: 30 range:30-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGVVITGRALVAAVAVVVAVLLGGAAEAQQLSPNFYSRTCPNLATIVRSGMASAVRTEPRMGASILRLFFHDCFVNGCDGSILLDDTSTFTGEKSAGPNANSARGFEVIDAIKTQVEASCKATVSCADILALAARDGVNLLGGPTWSVALGRKDSRTASQSAANSNLPGPGSSLATLISMFGNQGLSARDMTALSGAHTIGRAQCQFFRSRIYTERNINASFASLRQQTCPRSGGDANLAPFDVQTPDAFDNAYYQNLVSQRGLLHSDQELFNGGSQDGLVRQYSTNPSQFSSDFVSAMVKMGNLLPSSGTATEVRLNCRKVN*

Retrieve as FASTA  
Remarks chromosome 6. 22 ESTs. Rice blast fungus interaction, leaf library induced by M.grisea.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGAGTGGTGATCACCGGGCGGGCCTTGGTGGCCGCCGTCGCTGTCGTGGTCGCCGTTTTGCTCGGCGGAGCGGCGGAGGCGCAGCAGCTGTCCCCCAACTTCTACTCGAGGACG
TGCCCCAACCTGGCCACCATCGTGCGGTCCGGGATGGCGTCCGCCGTGCGGACGGAGCCCCGGATGGGGGCCTCCATCCTTCGCCTCTTCTTCCATGATTGCTTCGTCAAT
GTAATTAAG
CAACGCAACATTATTTTTAATTAATTTTTTTGGCTGGTGCTGTTGCTGATGAATGATCATGAGCTCATGAGTTATGGTTTTATGGTTGTCTGGTGGGGTTGGTTGCAGGGATGTGACGGC
TCGATCCTGCTTGACGACACGTCGACGTTCACCGGCGAGAAGAGCGCCGGCCCGAACGCCAACTCGGCCCGCGGGTTCGAGGTGATCGACGCCATCAAGACGCAGGTGGAGGCCTCCTGC
AAGGCCACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGCGACGGCGTCAACCTG
GTCAGTGTACTACATACGCTGCTCTGACACGTACGTGAAACCACCCGTACGTCACTGAAA
TTTTACCAGTGGCTGACATGTTCTTTTGGTGTGCAGCTGGGTGGGCCAACGTGGAGCGTGGCGCTGGGGCGGAAGGACTCGCGCACGGCGAGCCAGAGCGCGGCGAACAGCAACCTGCCG
GGGCCCGGGTCGAGCCTCGCCACGCTCATCAGCATGTTCGGCAACCAGGGCCTCTCGGCGCGCGACATGACGGCGCTGTCGGGCGCCCACACCATCGGCCGCGCCCAGTGCCAGTTCTTC
CGCAGCCGCATCTACACCGAGCGCAACATCAACGCCTCCTTCGCGTCGCTCCGGCAGCAGACGTGCCCGCGCTCCGGCGGCGACGCCAACCTCGCGCCGTTCGACGTGCAGACGCCCGAC
GCCTTCGACAACGCCTACTACCAGAACCTCGTGTCGCAGCGCGGCCTGCTCCACTCCGACCAGGAGCTCTTCAATGGCGGCTCGCAGGACGGCCTCGTCAGGCAGTACAGCACCAACCCC
TCCCAGTTCTCCTCCGACTTCGTCTCCGCCATGGTCAAGATGGGCAACCTGCTGCCGTCCTCCGGCACCGCCACGGAGGTCAGGCTCAACTGCAGGAAGGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGAGTGGTGATCACCGGGCGGGCCTTGGTGGCCGCCGTCGCTGTCGTGGTCGCCGTTTTGCTCGGCGGAGCGGCGGAGGCGCAGCAGCTGTCCCCCAACTTCTACTCGAGGACG
TGCCCCAACCTGGCCACCATCGTGCGGTCCGGGATGGCGTCCGCCGTGCGGACGGAGCCCCGGATGGGGGCCTCCATCCTTCGCCTCTTCTTCCATGATTGCTTCGTCAAT
GGATGTGAC
GGCTCGATCCTGCTTGACGACACGTCGACGTTCACCGGCGAGAAGAGCGCCGGCCCGAACGCCAACTCGGCCCGCGGGTTCGAGGTGATCGACGCCATCAAGACGCAGGTGGAGGCCTCC
TGCAAGGCCACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGCGACGGCGTCAACCTG
CTGGGTGGGCCAACGTGGAGCGTGGCGCTGGGGCGGAAGGACTCGCGCACGGCGAGC
CAGAGCGCGGCGAACAGCAACCTGCCGGGGCCCGGGTCGAGCCTCGCCACGCTCATCAGCATGTTCGGCAACCAGGGCCTCTCGGCGCGCGACATGACGGCGCTGTCGGGCGCCCACACC
ATCGGCCGCGCCCAGTGCCAGTTCTTCCGCAGCCGCATCTACACCGAGCGCAACATCAACGCCTCCTTCGCGTCGCTCCGGCAGCAGACGTGCCCGCGCTCCGGCGGCGACGCCAACCTC
GCGCCGTTCGACGTGCAGACGCCCGACGCCTTCGACAACGCCTACTACCAGAACCTCGTGTCGCAGCGCGGCCTGCTCCACTCCGACCAGGAGCTCTTCAATGGCGGCTCGCAGGACGGC
CTCGTCAGGCAGTACAGCACCAACCCCTCCCAGTTCTCCTCCGACTTCGTCTCCGCCATGGTCAAGATGGGCAACCTGCTGCCGTCCTCCGGCACCGCCACGGAGGTCAGGCTCAACTGC
AGGAAGGTGAACTAA

Retrieve as FASTA