Entry information : OsPrx88
Entry ID 1098
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx88
Name OsPrx88
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx88
start..stop
S start..stop
BdiPrx25 525 0 2..318 4..322
SbPrx136 523 0 4..318 10..329
ZmPrx106 511 0 27..318 32..323
SiPrx34 497 2e-179 4..318 7..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20329533..20329745 213 N° 2 20329236..20329427 192 N° 3 20328607..20329158 552  
complement(join(20328607..20329158,20329236..20329427,20329533..20329745))


exon

Literature and cross-references OsPrx88
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z7K0
DNA ref. GenBank:   NC_008399.1 (20329745..20328610)
Protein sequence: OsPrx88
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (295)
PWM (Da):   %s   33045.4 (30803.2) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.24 (7.24) Peptide Signal:   %s   cut: 24 range:24-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATQWVLVVVAVMAVLFAGGAAGGQLSTRYYDGKCPNVQSIVRAGMAQAVAAEPRMGASILRMFFHDCFVNGCDASILLDDTANFTGEKNAGPNANSVRGYEVIDAIKTQVEASCNATVSCADILALAARDAVNLLGGPTWTVQLGRRDALTASQSAANGNLPGPGSDLATLVTMFGNKGLSPRDMTALSGAHTLGQARCATFRSRIFGDGNVDAAFAALRQQACPQSGGDTTLAPIDVQTPDAFDNAYYANLVKKQGLFHSDQELFNGGSQDALVRKYAGNAGMFAADFAKAMVRMGALLPAAGTPTEVRLNCRKVN*

Retrieve as FASTA  
Remarks chromosome 6. No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCAATGGGTGCTCGTGGTGGTTGCTGTAATGGCCGTGCTCTTCGCCGGAGGCGCCGCCGGCGGGCAGCTGTCGACGAGGTACTACGACGGCAAGTGCCCGAACGTGCAGAGC
ATCGTGAGGGCCGGGATGGCGCAGGCCGTGGCGGCGGAGCCCCGGATGGGCGCCTCCATCCTCCGCATGTTCTTCCACGACTGCTTCGTCAAC
GTGAGATCGCATTGCCCATCTTAATTC
GCCATTAGTCTTGTTGGGGGGGGAGATGTTTGTGTTTGTGTTAATTTGTGTGTGCGGCTTGGCTGTCGTGTGATGCAGGGGTGCGACGCGTCCATCTTGCTCGACGACACGGCCAACTTC
ACCGGCGAAAAGAACGCCGGGCCGAACGCCAACTCGGTGCGCGGGTACGAGGTGATCGACGCCATCAAGACCCAGGTCGAGGCGTCCTGCAACGCCACCGTCTCCTGCGCCGACATCCTC
GCCCTCGCCGCGCGCGACGCCGTCAACCTG
GTACGCTTTGACACAAGCTAACCTCCAATGCAATCCAATCCCAATGCAGCACTTTGACACAAGCTACTCCGATGCAGCTGGGCGGGCCGA
CGTGGACGGTGCAGCTGGGTCGCCGCGACGCGCTGACGGCGAGCCAGAGCGCGGCGAACGGCAACCTGCCGGGGCCGGGGTCCGACCTCGCCACGCTCGTCACCATGTTCGGCAACAAGG
GGCTGTCGCCGCGGGACATGACGGCGCTGTCGGGCGCGCACACGCTGGGGCAGGCCCGGTGCGCCACGTTCCGCAGCCGCATCTTCGGCGACGGCAACGTCGACGCCGCCTTCGCCGCGC
TCCGGCAGCAGGCGTGCCCGCAGTCCGGCGGCGACACGACGCTGGCGCCCATCGACGTGCAGACGCCCGACGCGTTCGACAACGCCTACTACGCGAACCTGGTGAAGAAGCAGGGGCTGT
TCCACTCCGACCAGGAGCTGTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGGAAGTACGCCGGCAACGCCGGCATGTTCGCCGCCGACTTCGCCAAGGCGATGGTGAGGATGGGCGCCC
TCCTGCCGGCGGCCGGGACGCCGACCGAGGTCCGTCTGAACTGTAGGAAGGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCAATGGGTGCTCGTGGTGGTTGCTGTAATGGCCGTGCTCTTCGCCGGAGGCGCCGCCGGCGGGCAGCTGTCGACGAGGTACTACGACGGCAAGTGCCCGAACGTGCAGAGC
ATCGTGAGGGCCGGGATGGCGCAGGCCGTGGCGGCGGAGCCCCGGATGGGCGCCTCCATCCTCCGCATGTTCTTCCACGACTGCTTCGTCAAC
GGGTGCGACGCGTCCATCTTGCTCGAC
GACACGGCCAACTTCACCGGCGAAAAGAACGCCGGGCCGAACGCCAACTCGGTGCGCGGGTACGAGGTGATCGACGCCATCAAGACCCAGGTCGAGGCGTCCTGCAACGCCACCGTCTCC
TGCGCCGACATCCTCGCCCTCGCCGCGCGCGACGCCGTCAACCTG
CTGGGCGGGCCGACGTGGACGGTGCAGCTGGGTCGCCGCGACGCGCTGACGGCGAGCCAGAGCGCGGCGAACGGC
AACCTGCCGGGGCCGGGGTCCGACCTCGCCACGCTCGTCACCATGTTCGGCAACAAGGGGCTGTCGCCGCGGGACATGACGGCGCTGTCGGGCGCGCACACGCTGGGGCAGGCCCGGTGC
GCCACGTTCCGCAGCCGCATCTTCGGCGACGGCAACGTCGACGCCGCCTTCGCCGCGCTCCGGCAGCAGGCGTGCCCGCAGTCCGGCGGCGACACGACGCTGGCGCCCATCGACGTGCAG
ACGCCCGACGCGTTCGACAACGCCTACTACGCGAACCTGGTGAAGAAGCAGGGGCTGTTCCACTCCGACCAGGAGCTGTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGGAAGTACGCC
GGCAACGCCGGCATGTTCGCCGCCGACTTCGCCAAGGCGATGGTGAGGATGGGCGCCCTCCTGCCGGCGGCCGGGACGCCGACCGAGGTCCGTCTGAACTGTAGGAAGGTCAACTAA

Retrieve as FASTA