Entry information : EglPrx[P]184
Entry ID 11003
Creation 2012-05-15 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2012-05-15 (Qiang Li)
Peroxidase information: EglPrx[P]184
Name EglPrx[P]184
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx[P]184
start..stop
S start..stop
EcamPrx[P]184 94 8e-28 1..57 1..96
EgrPrx[P]184 92 4e-27 2..57 1..95
EguPrx[P]184 86 2e-24 2..57 1..95
EguPrx43 58 0.000000000003 17..56 282..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..48 48 N° 2 166..288 123  
join(1..48,166..288)


exon

Literature and cross-references EglPrx[P]184
Protein sequence: EglPrx[P]184
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   55
PWM (Da):   %s   5855  
PI (pH):   %s   8.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
LFADLP*SEASCSSGTNARNPFI*KNNFAATMVKMGKIVDLTGSIEEIRVKCRVING

Retrieve as FASTA  
Remarks Pseudogene from NGS. Short PS with stops and gap in it.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTGTTTGCAGACTTACCGTAATCTGAAGCTAGTTGTTCCAGTGGAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGCAAGAAATCCATTCATTTGAAAGAACAATTTTGCTGCTACAATGGTGAAGATGGGTAAAATTGTTGACTTG
ACCGGAAGTATTGAGGAGATTCGAGTAAAGTGCAGGGTCATTAATGGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTGTTTGCAGACTTACCGTAATCTGAAGCTAGTTGTTCCAGTGGAACCAATGCAAGAAATCCATTCATTTGAAAGAACAATTTTGCTGCTACAATGGTGAAGATGGGTAAAATTGTTGAC
TTGACCGGAAGTATTGAGGAGATTCGAGTAAAGTGCAGGGTCATTAATGGC

Retrieve as FASTA