Entry information : AtrPrx19
Entry ID 11004
Creation 2016-03-23 (Christophe Dunand)
Last sequence changes 2016-03-23 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-23 (Achraf Jemmat)
Peroxidase information: AtrPrx19
Name AtrPrx19
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Amborellaceae Amborella
Organism Amborella trichopoda    [TaxId: 13333 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtrPrx19
start..stop
S start..stop
GmPrx324 387 3e-136 7..303 28..327
GmPrx166 382 2e-134 7..303 28..327
MtPrx93 380 1e-133 8..303 29..327
EcamPrx85 353 5e-123 3..303 20..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..159 159 N° 2 995..1352 358 N° 3 1585..1979 395  
join(1..159,995..1352,1585..1979)


exon

Literature and cross-references AtrPrx19
Cluster/Prediction ref. Genebank:   18433660
Protein sequence: AtrPrx19
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   303
PWM (Da):   %s   33321.67  
PI (pH):   %s   7.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDVTLANLSYDHYHNSCPHLESLVAKTLMPIFLTDPTSPSAFLRLMFHDCQVQGCDASILLDSNGESISSEMLSGRNFGIRRREAIDMVKRVVEAECPTQVSCADLIILAARESVAFAGGPRIRVPLGRRDSTTASNRRADTYIPSSTVSVDNMLRIFMSKGMTMDEAIAILGGHTLGVSHCINVVNRLYPSYESEKLGAFGIYLRLNCPTMAPLTNLTFIPNDLTPFVFDNHYYKDLKAGRGLLSIDSSISTDPRTAPIVDRFSRDSDYFFFTFSSAFVKLSTVGVPTGKQGQIRNQCSQLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGTAACCTTGGCCAACCTTTCATATGATCACTACCACAACTCATGCCCCCATCTAGAGAGCCTGGTAGCAAAAACACTCATGCCTATCTTCCTAACTGATCCCACCTCTCCCTCT
GCATTCTTAAGGCTCATGTTCCATGATTGCCAAGTTCAG
GTATTCACTCTCTTTGATTTGCAATTTTCGCGGCTATTTTTTTTTTTTTTGGTAATTCAGTGGAGAAGACGGGTCGCTACT
TTTTTTTTAAAAAGTTTAATAGTTAAGTTGTTTGGAAGGTATTTGTAGGGTGGCCTTTACCCGTTTTTTCAAATAGTTTAAGAATGAGTTTTTTTTTAAGTTGTTCGTAAGGTAGTGTTA
GTGAGAATGAAAACACAACGTTGTGACTAAGATGGGGGATGCTACCATCAAGACTTAGCCCCTTTCCCAAAGTCCGTGCTTCTCTCTCTCTCATTTGCACTTTTCATGACTATTATTACT
CCTTTTATTCTGGGAAGGTACAATGCTCCTTAAAACTACTACATATAGACAGATCCTTAAGGCAAGTTTATTTCACTTGAAAGGGCTCTCGCAAAGTTTGTTCATTGAGAGAGCTTTCCT
ATTAGCCTGAAAAAGCGCTTCACACTTAAATAGATAAAACGCTGCTTTTCCACTAAAAGTGAGGAAAGTTTGAGAAGCACTTTCGTTGCTTCTAAGCAACACCCACTTTCCCATAACAAA
CGTGGGGAAACAGTAGTCTAGCGCAAACGAACTTTCACAAGTTCTTTTCCGCTAAAACTAATGTGTCTTTAAGGTCATCAGAGTCCACCTAACTAGTGAAAGGTGATGAAGAGCCCACAA
TTAGCATCTATCATGTCTTTTTCCAGTGGATCACACTCACTCTCTATAATCACTGGTCATTTTCATGCAATTTTCGTAGTCCTTATGATCATAGTATACTACTTTCCTTCCCACAAATTC
ATGAAGTGTTAGATTGATTATAAAGAGTTTACAGGGTTGTGATGCCTCCATACTGTTGGATTCGAATGGCGAAAGCATAAGCTCTGAGATGCTTTCCGGAAGAAACTTCGGCATAAGGAG
GAGAGAAGCCATCGACATGGTGAAGAGAGTGGTGGAGGCCGAGTGTCCTACTCAGGTCTCTTGCGCTGATCTCATAATTCTGGCTGCTAGAGAATCGGTGGCCTTCGCTGGAGGACCGCG
GATTCGAGTTCCACTGGGTAGGAGGGATTCCACCACTGCAAGCAATCGAAGAGCTGACACCTATATTCCTTCATCTACGGTTAGTGTAGACAACATGCTTCGCATTTTCATGAGCAAAGG
GATGACAATGGATGAAGCAATCGCCATTCTAG
GTAAAAAAAAAAAGAAGAAGCAATATTACAGTAATGGAGAATTACTAACATGAAAAGCCTTACCTCATTGCTACATGTTAAATGCATC
ATTAAGCAACTGCAGTAACAACTTACGGTTCGGGATGCATGAAGCATGGTGTTGCTCTGGTAAAGGCTATCATGTTATACAGATAACAATATTGATTAATCATGGTAATTGCAATGGTGA
TGGTGAAATTAAGGATTTTTGCAGGTGGGCATACACTGGGAGTGAGCCACTGCATAAATGTTGTGAATCGGTTGTATCCGTCTTATGAGAGCGAGAAACTAGGGGCTTTTGGAATATATC
TACGACTGAATTGCCCGACAATGGCTCCCTTAACAAACCTAACCTTCATTCCTAATGATCTTACGCCTTTCGTATTCGACAATCATTACTATAAGGACCTCAAGGCGGGTAGAGGCTTAT
TGAGCATCGATTCAAGCATATCTACAGACCCTCGAACGGCTCCAATTGTTGACAGGTTCTCTAGAGACAGTGACTACTTCTTCTTCACCTTCTCTTCAGCTTTTGTTAAGCTTTCAACCG
TGGGTGTTCCTACAGGAAAACAAGGACAGATACGAAACCAGTGCAGCCAGCTCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGTAACCTTGGCCAACCTTTCATATGATCACTACCACAACTCATGCCCCCATCTAGAGAGCCTGGTAGCAAAAACACTCATGCCTATCTTCCTAACTGATCCCACCTCTCCCTCT
GCATTCTTAAGGCTCATGTTCCATGATTGCCAAGTTCAG
GGTTGTGATGCCTCCATACTGTTGGATTCGAATGGCGAAAGCATAAGCTCTGAGATGCTTTCCGGAAGAAACTTCGGCATA
AGGAGGAGAGAAGCCATCGACATGGTGAAGAGAGTGGTGGAGGCCGAGTGTCCTACTCAGGTCTCTTGCGCTGATCTCATAATTCTGGCTGCTAGAGAATCGGTGGCCTTCGCTGGAGGA
CCGCGGATTCGAGTTCCACTGGGTAGGAGGGATTCCACCACTGCAAGCAATCGAAGAGCTGACACCTATATTCCTTCATCTACGGTTAGTGTAGACAACATGCTTCGCATTTTCATGAGC
AAAGGGATGACAATGGATGAAGCAATCGCCATTCTAG
GTGGGCATACACTGGGAGTGAGCCACTGCATAAATGTTGTGAATCGGTTGTATCCGTCTTATGAGAGCGAGAAACTAGGGGCT
TTTGGAATATATCTACGACTGAATTGCCCGACAATGGCTCCCTTAACAAACCTAACCTTCATTCCTAATGATCTTACGCCTTTCGTATTCGACAATCATTACTATAAGGACCTCAAGGCG
GGTAGAGGCTTATTGAGCATCGATTCAAGCATATCTACAGACCCTCGAACGGCTCCAATTGTTGACAGGTTCTCTAGAGACAGTGACTACTTCTTCTTCACCTTCTCTTCAGCTTTTGTT
AAGCTTTCAACCGTGGGTGTTCCTACAGGAAAACAAGGACAGATACGAAACCAGTGCAGCCAGCTCAATTAG

Retrieve as FASTA