Entry information : EglRboh04
Entry ID 11030
Creation 2012-05-18 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-03-13 (Qiang Li)
Peroxidase information: EglRboh04
Name EglRboh04
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglRboh04
start..stop
S start..stop
EgrRboh04 1857 0 1..889 1..889
EcamRboh04 1845 0 1..889 1..889
EguRboh04 1778 0 1..889 1..889
PtRboh10 1470 0 1..889 1..886
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..511 511 N° 2 733..892 160 N° 3 1006..1054 49 N° 4 1165..1278 114
N° 5 1446..1880 435 N° 6 2022..2408 387 N° 7 2509..2604 96 N° 8 2738..2853 116
N° 9 2963..3065 103 N° 10 3250..3323 74 N° 11 3466..3980 515 N° 12 4119..4228 110
join(1..511,733..892,1006..1054,1165..1278,1446..1880,2022..2408,2509..2604,2738 ..2853,2963..3065,3250..3323,3466..3980,4119..4228)


exon

Literature and cross-references EglRboh04
Protein sequence: EglRboh04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   889
PWM (Da):   %s   100936.61 Transmb domain:   %s   o340-359i480-502o522-544i704-721o
PI (pH):   %s   9.28
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIQDHHQHAQWSDTESNCSSRLGYSGPLSSTSTKIRSNARFRDDQDEECYVEITLDVGEDSVSVHNIKGGGDPETALFTSRLGLRPSSLGAQLSFRLRQVSQELRRITSTKGRNNQIDRTRSGAARALRGLQFMTKNVEIDQGWSEVEARFDELALNGVLPKSLFGQCIGMNESSEFASELFDALARRRGITSSAVSKPELREFWEQIADQSFDARLQTFFDMVDKNADGRITEEEVKIIALSASANKLSKIQEQAEEYAALIMEELDPSNLGYIELHNLETLLLQAPIQSRSAHAGSESRVLSQMLSQKLVPTREHNPIKRYYKALAYFIEDNWKRIWVMGLWISICAGLFTWKFIQYKHRAVFDVMGYCVTTAKGGAETTKFNMALILLPVCRNTVTWLRSRTRLGVIVPFNDNINFHKVIAWGIAVGVGLHAGAHLTCDFPRLLHATDAEYEPMKQFFGEKRPNNYWWFVKGTEGWTGVSMLVLMTIAYTLAQPWFRRNRLDLPKALKKLTGFNAFWYSHHLFVIVYVLFVIHGYFLYLAKKWYKRTTWMYLAVPVTLYASERLLRALRSGYKTVRIFKVAVYPGNVMALHMSKAQGFRYTSGQYIFVNCAAVSPFQWHPFSITSAPGDDYLSLHIRTVGDWTSQLKAVFSACQPPSIDQSGLLRADIATGENVPRIPRLLIDGPYGAPAQDYKNYDVLLLVGLGIGATPLISIVKDVLNNIKQQKEMEKGIVESGAKSNKRKPFLTRRAYFYWVTREQGSFEWFRGVMNEVAENDRDGVIELHNYCTSVYEEGDARSALIAMLQSLNHAKNGVDIVSGTRVRTHFARPNWRNVFKHVAVNHPDERGVFYCGVQGVVGEMRRLAQDFSHKTTTKFYFHKENF

Retrieve as FASTA  
Remarks Complete sequence from NGS.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATCCAAGATCATCACCAGCATGCTCAGTGGTCTGACACAGAAAGCAATTGTAGCTCCAGACTTGGTTATAGTGGCCCTTTGAGTAGCACGAGCACCAAGATCAGAAGCAATGCA
AGATTCAGGGACGACCAAGATGAGGAATGCTATGTCGAGATCACGCTAGATGTCGGCGAGGATAGCGTCTCGGTTCACAACATCAAGGGAGGAGGAGATCCTGAGACGGCATTGTTCACG
AGTCGCTTGGGGCTGCGGCCCTCATCGCTCGGTGCACAGCTGTCGTTCAGGCTCAGACAAGTCTCACAAGAGCTCAGGCGAATCACCTCGACGAAAGGGCGTAATAATCAGATCGATAGG
ACTAGATCCGGTGCTGCACGGGCATTGCGAGGGCTCCAGTTTATGACCAAGAATGTCGAGATCGATCAAGGTTGGTCTGAGGTCGAAGCAAGGTTCGATGAATTGGCTCTTAATGGAGTT
CTTCCGAAATCACTCTTCGGCCAGTGTATAG
GTATGTCAACTGATTTTGCTAAAAAGAAATGCTAGAATCGAATACTTAATTTATATAAACAAATGTTGATTGTTTCAAACGGAAAGATT
TGCATTTATCACATTGTTCCATCTCAAGAATATTCTGTCAACTCATTTAGTCCTTCGATACATTTCTTAGAAATTAGTGAACTTGCATTAAATTAGAGCAGCGGACTGACAAGGATCGTT
GCATCTGTTTAGGGATGAATGAATCCAGTGAGTTTGCCAGCGAGCTATTTGACGCGCTGGCACGACGGAGAGGCATAACATCGTCTGCGGTAAGCAAGCCTGAGCTACGGGAATTCTGGG
AACAGATAGCAGATCAAAGCTTCGATGCGAGGTTGCAAACCTTCTTCGATAT
GTAAGTTCACTTGCCCATTTCACTATAATAGCTTTCACTTTGAATCAACTAAAAATCAGGTTTACTTG
GGACTTATTCAGACAAATCCACTGAGAAGTTATTTAATGATGCAGGGTAGACAAAAATGCAGATGGTCGGATCACCGAGGAAGAGGTGAAAGAGGTAAGAGATGGTCAAGAAAAGAATAT
GATGATGATGATGATGAGAAATGATTCAATGTGAGAGAATAATTAATAAGTTACTAATTGTGATCATATCATTGTCAACATCAGATAATTGCACTAAGCGCTTCAGCGAATAAGCTGTCA
AAGATCCAAGAACAAGCTGAGGAATATGCAGCCTTGATCATGGAAGAGTTGGATCCTAGTAATCTGGGATACATTGAG
GTACATGTTCAGATCCAAACCTTCGACTTTTTTAAATGATTG
TTGACCATACGACCCACGTACCGTGCTTACTAATATTCAATTACTTATCTAAGATATTGCCTTGATTTAAAAGTCTAAATTGAGTCAAGTACCTGAGAAGAGCATCTGCTGAACTCCTGT
TTTAGCTACACAACCTGGAGACACTCCTCTTGCAAGCCCCGATCCAATCAAGGTCGGCCCACGCCGGGTCCGAGAGCCGGGTCCTGAGCCAGATGCTGAGCCAGAAGCTGGTCCCAACCA
GAGAGCACAACCCCATCAAGAGATACTACAAGGCACTGGCCTACTTCATTGAGGACAATTGGAAGAGGATTTGGGTCATGGGCCTATGGATCTCAATCTGTGCAGGCCTGTTCACTTGGA
AGTTCATCCAGTACAAGCACAGAGCTGTGTTTGATGTGATGGGCTACTGTGTGACCACAGCTAAAGGTGGAGCTGAGACTACCAAGTTCAACATGGCCCTGATTTTGCTTCCAGTTTGCA
GAAACACAGTCACTTGGCTGAGGAGTAGAACCAGGTTGGGTGTGATTGTTCCCTTCAATGACAACATCAATTTCCACAAG
GTATGAACATATTATGCCGCGATAAATTTAGTTGAAAAGT
GTATTTGGATATGCTTTGAAGGAAAAATTGAAAGAGAACATAATTTACTTCATTAAGCACTTAATCTAATTATAAGCGTTAAATGTATGTGGCCTAAATAGGTGATAGCTTGGGGCATTG
CGGTTGGGGTTGGTCTACATGCCGGAGCCCATCTGACCTGCGACTTCCCTAGGCTGCTCCATGCCACCGATGCTGAATACGAGCCAATGAAGCAGTTCTTCGGCGAGAAGCGCCCCAATA
ACTACTGGTGGTTCGTGAAAGGGACTGAGGGCTGGACCGGTGTGTCCATGCTGGTGCTGATGACCATAGCATACACCTTAGCCCAGCCCTGGTTCCGCCGCAACCGGCTGGACCTCCCCA
AGGCCCTCAAAAAGCTCACCGGGTTCAATGCTTTTTGGTACTCGCACCACCTCTTTGTGATCGTCTACGTGCTCTTCGTGATACACGGCTACTTCTTGTATTTAGCCAAGAAGTGGTACA
AGAGAACG
GTGAGTGATAATCTACATCACATTGCTTGGTAATTAATGAGATTTTTACAGTTTGTCCAATATCACATTTCTAACTATGTCTATAAACTCGTTTGCGCAGACCTGGATGTAT
CTTGCAGTACCAGTCACATTATATGCGTCCGAGCGCTTGCTCCGTGCGCTCAGGTCTGGGTACAAGACCGTGCGGATCTTCAAG
GTGAGGCTCGGATTCGATTAAGAGTTGTTCTGTTTT
GAAACACTGCAGAATAGTTGTCCAGACTGATGTTTTAAAACACGAGGCATTCACAATCACAATAACTGAGTTGGGGTCATATTCTGGTGCGTTTCAGGTTGCAGTTTATCCAGGAAATGT
CATGGCTCTGCACATGTCTAAGGCTCAAGGCTTCAGATACACAAGCGGTCAATACATTTTTGTGAACTGTGCAGCTGTTTCTCCATTCCAATG
GTAACTTTTATTTTTTAACAAAAAAGA
CAGGAAAATGATTACTTCTGTACATTACTTGTATTAGCCATTGAAAAGGAACTTGGCTAACTGGTCAATCGAACATTATCAGGCATCCATTTTCGATCACCTCAGCACCCGGCGACGATT
ACTTAAGCCTTCATATACGCACCGTGGGCGACTGGACATCTCAGCTTAAAGCTGTATTCTCGAAG
GTGATTGTTCGAGTTTATTTCTAAGTAACTTTGCGACATACTTGGTCCTGCCTAT
TGGCAACCGATTGCGAGAAATCTTCTGAACTTAAGTAAGGTCCGCATCAGTCTAATTACGACATGCTGTCGTATGGATGTATATGCTCTTTAAAAACATGACGAAAAGTCACATTGTGAA
TGTGTGTAGGCATGTCAGCCTCCATCAATTGATCAAAGTGGACTTCTAAGAGCAGATATCGCAACAGGAGAAAATGTGCCCAGGTAATTAGACTTGTTCGCGCAGCTCATGGTCTGCTCG
GCTCGCTAGGCTTGAAGTCTAGATGAGCAGATTCAGGCAACACGAACATAGCGTATACAGTTTTTCGTAGAATGGGCAAGCTAATTGGATATCATTTTCAACTAGGATTCCGAGGCTCTT
GATCGACGGTCCATACGGTGCTCCAGCACAAGACTACAAGAATTACGACGTGCTTCTCCTAGTCGGGCTTGGCATCGGTGCGACACCATTGATCAGCATCGTCAAGGACGTCCTCAACAA
CATCAAGCAGCAGAAAGAGATGGAAAAGGGCATCGTAGAGAGCGGCGCGAAGAGCAACAAGCGAAAGCCGTTCCTGACCCGGCGGGCCTACTTCTACTGGGTCACCCGTGAGCAGGGCTC
GTTCGAGTGGTTCAGAGGCGTGATGAACGAGGTCGCCGAGAACGACAGGGACGGCGTGATCGAGCTCCACAACTACTGCACCAGCGTGTACGAGGAGGGCGACGCCCGGTCGGCCCTGAT
CGCGATGCTCCAGTCCCTGAACCACGCCAAGAACGGGGTCGACATCGTGTCGGGCACCCGGGTACGGACGCACTTCGCGAGGCCCAACTGGCGCAACGTCTTCAAGCATGTCGCGGTCAA
CCACCCCGACGAAAGAGTTG
GTGAGCATCCTAAAGCACGTCTAGCACATATTTTCCAGGAAGCATAGACATAATTCACTCCAATAAATGATTAATTATCACATTTTCAGCATCTACTCGT
GAGTCGACTAATGTCAAGATGTTTCCTTTCTTCTACAGGAGTGTTTTATTGTGGCGTACAAGGGGTGGTTGGGGAGATGAGGAGGTTGGCTCAGGACTTCTCCCACAAGACCACCACCAA
GTTCTATTTCCACAAAGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATCCAAGATCATCACCAGCATGCTCAGTGGTCTGACACAGAAAGCAATTGTAGCTCCAGACTTGGTTATAGTGGCCCTTTGAGTAGCACGAGCACCAAGATCAGAAGCAATGCA
AGATTCAGGGACGACCAAGATGAGGAATGCTATGTCGAGATCACGCTAGATGTCGGCGAGGATAGCGTCTCGGTTCACAACATCAAGGGAGGAGGAGATCCTGAGACGGCATTGTTCACG
AGTCGCTTGGGGCTGCGGCCCTCATCGCTCGGTGCACAGCTGTCGTTCAGGCTCAGACAAGTCTCACAAGAGCTCAGGCGAATCACCTCGACGAAAGGGCGTAATAATCAGATCGATAGG
ACTAGATCCGGTGCTGCACGGGCATTGCGAGGGCTCCAGTTTATGACCAAGAATGTCGAGATCGATCAAGGTTGGTCTGAGGTCGAAGCAAGGTTCGATGAATTGGCTCTTAATGGAGTT
CTTCCGAAATCACTCTTCGGCCAGTGTATAG
GGATGAATGAATCCAGTGAGTTTGCCAGCGAGCTATTTGACGCGCTGGCACGACGGAGAGGCATAACATCGTCTGCGGTAAGCAAGCCT
GAGCTACGGGAATTCTGGGAACAGATAGCAGATCAAAGCTTCGATGCGAGGTTGCAAACCTTCTTCGATAT
GGTAGACAAAAATGCAGATGGTCGGATCACCGAGGAAGAGGTGAAAGAG
ATAATTGCACTAAGCGCTTCAGCGAATAAGCTGTCAAAGATCCAAGAACAAGCTGAGGAATATGCAGCCTTGATCATGGAAGAGTTGGATCCTAGTAATCTGGGATACATTGAGCTACAC
AACCTGGAGACACTCCTCTTGCAAGCCCCGATCCAATCAAGGTCGGCCCACGCCGGGTCCGAGAGCCGGGTCCTGAGCCAGATGCTGAGCCAGAAGCTGGTCCCAACCAGAGAGCACAAC
CCCATCAAGAGATACTACAAGGCACTGGCCTACTTCATTGAGGACAATTGGAAGAGGATTTGGGTCATGGGCCTATGGATCTCAATCTGTGCAGGCCTGTTCACTTGGAAGTTCATCCAG
TACAAGCACAGAGCTGTGTTTGATGTGATGGGCTACTGTGTGACCACAGCTAAAGGTGGAGCTGAGACTACCAAGTTCAACATGGCCCTGATTTTGCTTCCAGTTTGCAGAAACACAGTC
ACTTGGCTGAGGAGTAGAACCAGGTTGGGTGTGATTGTTCCCTTCAATGACAACATCAATTTCCACAAG
GTGATAGCTTGGGGCATTGCGGTTGGGGTTGGTCTACATGCCGGAGCCCAT
CTGACCTGCGACTTCCCTAGGCTGCTCCATGCCACCGATGCTGAATACGAGCCAATGAAGCAGTTCTTCGGCGAGAAGCGCCCCAATAACTACTGGTGGTTCGTGAAAGGGACTGAGGGC
TGGACCGGTGTGTCCATGCTGGTGCTGATGACCATAGCATACACCTTAGCCCAGCCCTGGTTCCGCCGCAACCGGCTGGACCTCCCCAAGGCCCTCAAAAAGCTCACCGGGTTCAATGCT
TTTTGGTACTCGCACCACCTCTTTGTGATCGTCTACGTGCTCTTCGTGATACACGGCTACTTCTTGTATTTAGCCAAGAAGTGGTACAAGAGAACG
ACCTGGATGTATCTTGCAGTACCA
GTCACATTATATGCGTCCGAGCGCTTGCTCCGTGCGCTCAGGTCTGGGTACAAGACCGTGCGGATCTTCAAG
GTTGCAGTTTATCCAGGAAATGTCATGGCTCTGCACATGTCTAAGGCT
CAAGGCTTCAGATACACAAGCGGTCAATACATTTTTGTGAACTGTGCAGCTGTTTCTCCATTCCAATG
GCATCCATTTTCGATCACCTCAGCACCCGGCGACGATTACTTAAGCCTTCAT
ATACGCACCGTGGGCGACTGGACATCTCAGCTTAAAGCTGTATTCTCGAAG
GCATGTCAGCCTCCATCAATTGATCAAAGTGGACTTCTAAGAGCAGATATCGCAACAGGAGAAAATGTG
CCCAG
GATTCCGAGGCTCTTGATCGACGGTCCATACGGTGCTCCAGCACAAGACTACAAGAATTACGACGTGCTTCTCCTAGTCGGGCTTGGCATCGGTGCGACACCATTGATCAGCATC
GTCAAGGACGTCCTCAACAACATCAAGCAGCAGAAAGAGATGGAAAAGGGCATCGTAGAGAGCGGCGCGAAGAGCAACAAGCGAAAGCCGTTCCTGACCCGGCGGGCCTACTTCTACTGG
GTCACCCGTGAGCAGGGCTCGTTCGAGTGGTTCAGAGGCGTGATGAACGAGGTCGCCGAGAACGACAGGGACGGCGTGATCGAGCTCCACAACTACTGCACCAGCGTGTACGAGGAGGGC
GACGCCCGGTCGGCCCTGATCGCGATGCTCCAGTCCCTGAACCACGCCAAGAACGGGGTCGACATCGTGTCGGGCACCCGGGTACGGACGCACTTCGCGAGGCCCAACTGGCGCAACGTC
TTCAAGCATGTCGCGGTCAACCACCCCGACGAAAGAGTTG
GAGTGTTTTATTGTGGCGTACAAGGGGTGGTTGGGGAGATGAGGAGGTTGGCTCAGGACTTCTCCCACAAGACCACCACC
AAGTTCTATTTCCACAAAGAGAACTTTTAG

Retrieve as FASTA