Entry information : EglRboh02
Entry ID 11033
Creation 2012-05-18 (Qiang Li)
Last sequence changes 2013-03-13 (Qiang Li)
Sequence status partial
Reviewer Christophe Dunand
Last annotation changes 2016-04-07 (Christophe Dunand)
Peroxidase information: EglRboh02
Name EglRboh02
Class Respiratory burst oxidase homolog    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglRboh02
start..stop
S start..stop
EgrRboh02 1573 0 23..815 153..965
EgrRboh02 94 5e-20 1..62 1..62
EcamRboh02 1558 0 23..815 152..964
EcamRboh02 92 4e-19 1..62 1..62
EguRboh02 1556 0 23..815 153..965
EguRboh02 94 5e-20 1..62 1..62
GmRboh12 1337 0 45..815 140..941
GmRboh12 55 0.00000006 1..44 1..44
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..132 132 N° 2 487..709 223 N° 3 823..982 160 N° 4 1369..1417 49
N° 5 2169..2282 114 N° 6 3849..4271 423 N° 7 5812..6198 387 N° 8 6584..6699 116
N° 9 6841..7008 168 N° 10 7125..7284 160 N° 11 7428..7625 198 N° 12 7726..7854 129
N° 13 7969..8047 79 N° 14 8142..8251 110  
join(1..132,487..709,823..982,1369..1417,2169..2282,3849..4271,5812..6198,6584.. 6699,6841..7008,7125..7284,7428..7625,7726..7854,7969..8047,8142..8251)


exon

Literature and cross-references EglRboh02
Protein sequence: EglRboh02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   815
PWM (Da):   %s   92675.95 Transmb domain:   %s   o285-304i424-446o466-488i613-630o
PI (pH):   %s   9.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGLAKHGRRWASDTVPGKSPASDSTSPAGTEASYGEELVEVTLAGGFDVALAARALRKQRAQLDRNRSGAQKALRGLRFISNSKTNCSIDAWNEIQASFDKLAKDGCLYRQDFAQCIGMKDSKEFALELFDALGRRRRMKVDRISKDELHEFWCQITDQSFDSRLQIFFDMVDKNEDGRITGEEVKIIMLSASANRLSRLKEQAEEYAALIMEELDPEQLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRRRSRIRRLSTKCLYYLEENWRRIWVVTLWVMIMIGLFTWKFVQYKQKAAFQVMGYCLLTAKGAAETLKFNMALILLPVCRNTITWLRNTRVGLFIPFDDNINFHKTIAAAIVVGVILHVGDHLACDFVRLEHASKDVYHRYLEDDFGNPKPTYFDLVKGIEGVTGILMVILMLIAFTLATRWFRRSLVKLPKPFDRLTGFNAFWYSHHLFVLVYILLIIHGVFLYLVHHWYRKTVAIYPGNVLTLKMSKPPQFKYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDFLSVHIRQLGDWTQELKRVFAEACEPPVAGKSGLLRADETTKKSLPKLCIDGPYGAPAQDYKKYDVLLLVGLGIGATPFISILKDLINTIVKSEEQDSVTDVSRNSDLSIGSVESPGPNRVSPRRRKTLKTTNAYFYWVTREQGSFDWFKGVMNEVAEIDQRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGIDIVSGTTVRTHFARPNRKKAFNKLCSKHSGARIGVFYCGAPVLAKELSKLCYEFNQKGPTKFDFHKEHF

Retrieve as FASTA  
Remarks Partial sequence from NGS. Parts of the sequence are missing due to NNNN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGCCTCGCCAAGCACGGGCGCCGGTGGGCGTCGGACACCGTCCCCGGCAAGTCACCGGCCAGCGACAGCACTTCGCCGGCGGGTACGGAGGCCAGCTACGGCGAGGAGCTCGTG
GAGGTGACCCTC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGCCGGCGGCTTCGACGTGGCCCTGGCGGCCCGGGCCCTGCGGAAGCAGCGCGCGCAGCTCGACCGGAACCGCTCGGGCGCCCAAAAGGCCTTGCGCGGGCTGCGGTTCATCAGC
AACAGCAAGACCAACTGCAGCATCGATGCATGGAACGAAATTCAGGCTAGCTTCGATAAGCTTGCCAAAGATGGTTGTCTCTATCGTCAAGATTTCGCACAATGCATAG
GTTTTCGCCAT
CTCTCTCTCTCTCTCTCTCTCTCTAAATTCACGTCCCTTTATGGTGGATTTCTCTCCTTAGCGTTCATACTGACGACGTCCTTGTCTTTTTTCCCGGTGAAGGAATGAAAGATTCGAAGG
AGTTTGCTTTGGAACTGTTCGATGCATTGGGGAGGAGGAGGAGAATGAAGGTCGACAGGATCAGCAAAGACGAGCTCCACGAGTTCTGGTGTCAGATCACTGATCAGAGCTTCGATTCAC
GTCTCCAGATCTTCTTCGACAT
GTACGCATGATGATCGCGATGATGATGATGAATTAAAAAAAAAGAAAANNNNNNNNNNNNNNAACTTTTTTCTTTTCTTCTTTTTTTTTTTACACTGT
TGTGTTTTGATAAAGATTGCACTTCTTTAACAAACTAAGGAACAGACCGATTCATCTCCATTAGGTATTTTTAATTATTTTCATATTAACGCGAGATGATTGTGTATTGTCAGTGGGTAA
AGAGCCAGAAGCGAGAAAAGCAAGAACAGGGACCGCTGAACAATATCTTAATTATGGACCTAATTATTGATCGAGTCATATGTTTTTTATTTGCACCTAGTACGTTTTTCATTAAAAACA
ATCTGTTTGGTCGATAATTAATCTTTTCTCTTGTTGAATACATGACAGGGTAGACAAGAACGAGGACGGAAGAATCACCGGAGAAGAAGTAAAAGAGGTGAGAGTTCTGTTTGAACCGAT
TGTCATTAGCTGTCATTTTCGAGAAAATTAAAGCTCGATAAGACCCGGCGACCCTGTTAAACTAAACTCCTAGACTGATTATATATATGCGCAATAGATTGGACCGTACATAATTAATTG
GAATAGGAACTAATGTGCATGAATTAGCCAACACTCCTTCATGTCCTCGTGTAAGCCATCGCAATAAACTAGGTTTTCCTTACAGGGTGTCATGTTTCGGTTACAATATAATAATCGATG
TTAGGCGAGGTTCGGTGAGCCCCAAAAATCCCTGAAATTCCACAACGAAACTACTCCATCACAACGATAACAAAAAAAAGAAAGCGAAGTTTTATAAAATAATGTTTCGGTTTTTTCTTT
TTTCCTTCCTGGGCTTGCTCTGACGTTGCCCATGTTCTAAAAGCATCTTCTTATTCATTAAAGATTTTTTGGGGGTATTCGTGGGTTTCCATGAGCTCTTAGGCCCCCTATTCCGTGATG
TCTAGGGGGACAAATGGCAAGTTTTCTCCACTACAATCGTATTCCCGAACGCAATAATTACTATTTTCAGTGGGGTTGGTGGGGGCTTTTCGGTCAACTCGGGGCCGGTCCGACGTGTCA
CGGTTGTCTTCTTGATGCATGCAACCTTGGGTTACGTGGACTTGCGAGTCATTAATGCCCGGTTGACGTAAAGAACCCTAATTTCCACAGTTCCTGTTCTTGATTTTGATTGCTGCCGAT
GGTTGCAGATCATAATGCTGAGCGCCTCGGCGAATCGATTATCGAGGTTGAAGGAGCAGGCGGAGGAGTACGCAGCTCTGATCATGGAAGAACTGGATCCGGAGCAGCTCGGCTACATCG
AG
GTCGGTCCATTTTTTTATTTTATTTTTATGATTTCGCCCTAAAATCTAAAGATAATGCAAAGTCCAAAATACATATATTTCGTCAGACTATAGTTTTCCCAATAGTTAGTGGGGATAC
GCATCTTAATCGAGTCAGCTTTGACCAGTAGTTTTTTTATAAGAGTAATACTCGAGGGGGTCTAAGTATTAGTTACGACTTTTCCTCCTAAAGTCCATGTTTGGCGAAAAATGGAAATTT
TTTTCTAAGAATTGGGTAACCGTGTTGTTGAACCGCGCAAGAAGAAAATAGTAAAAGCTTATGACTATATATAAATATATGTGTGTATATATTCATATTAATATTTGTAGACGTAGCTAG
CGCATTACTTTTGGATTGACCAAATTAGATTGTTTAGAAGGCAAAAGCAGCTGACGAAATTTCTAAAATTTTTGGTAGTTGAGCGACTTTTCTTCGACCTTCAAGCCCATTTCTTCTAAA
AGTTTCGGTAATTAGGGTTTCTCCTTTCCGTGGTAACTTTGTTATTTCTAGGTCAGTGCAATAATTGGTACGACCGATAAGCCACGCATATCATGTCATCTTCCTTACTTTGTTGTCCTT
AATCAAGCAATAAATCTAGGGTCCGATTGAATGGACTTAAATCAAAATGGCAAAAAATAAAATAAAATTTGTGGCCGATACATTAACACAAGCTGTTTTATCATGTAGTTACAGCCAAAA
AGAAGGGTAGCCTTAACATAATAAATTCTCAAATAATTATATTCGTAATCGTTTTATTTATTCCTTAAGTATATAGCAAGAATAGGTGAGTTCCGGTCTTTCTGGGTCCGAGAGCATGTC
CATCGCGCCTGCGTTTGACACCTTTCCTGGCTGTACTCACACGACGAATCTTCTGCACTAAATTCTCATTTTTCTTTTCTTTTCTCGGCTGCTAAAGATTTTCCGGGGAAATTTCAGTCC
TCCCAATGGCGGAGAAAAACCGACGTAGATATGCATCGCGATTGGTGGCATGTAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTAGACCACA
CCCGGTGCACGAAATTTCCCCGCGTGCTGTCCTGTTTCGGTGGTCACCGTCGCTGGGGGGTCTGTCGAGCTTTTTCTCGACCCGATCCCTCTTTTGTCTTTTCCGCCTCGTCCCATCCCA
CGATTCCGATCCTAAAGAGACGCTCGTTGAATTCGAGAGTTTCCGTGATGGCGAACATGGGGAACGATGGGAAGCGCCAGACTTCGAGACTAACAACATCTCGTTTTCCTTTAACTAAAA
CTGATGTCATCGTATGCGTGGAACGTTTCTTGCTTTTGGTCACATGCGACGGTGACGCATCGATTCCATGGATCGAGGGGCGGTGCCCATGTCATGCACAAAGCTTTCTACTCATGGCAG
AAAAAAAGAGGAGGAAAAATCCCACTTAAAATGTAAATGACATGGGAGAAAAGTAAAATTTTACCGGCTTTAGCTTGCAATTTAGCCTGCAATTTAGCCCCTGAATTCTTGGTGAAAATC
GGATGCAGCTATGGCAACTGGAGACGCTGCTGCTACAGAAGGATACGTACCTAAACTACAGCCAGGCGCTGAGCTACACGAGCCAAGCGCTGAGCCAAAACCTGCAGGGCCTGAGGAGGA
GGAGCCGCATCAGGAGACTGAGCACCAAGTGCCTGTACTATCTGGAAGAGAACTGGAGGAGGATTTGGGTGGTGACCTTGTGGGTCATGATCATGATCGGCCTCTTCACCTGGAAGTTCG
TGCAGTACAAGCAGAAGGCCGCCTTCCAGGTCATGGGCTATTGCCTCCTCACGGCGAAGGGGGCCGCCGAGACGCTCAAGTTCAACATGGCCCTCATCCTGCTGCCGGTGTGCCGGAACA
CCATCACTTGGCTCCGCAACACGAGGGTCGGCCTCTTCATACCCTTCGACGACAACATCAACTTTCACAAG
GTGCGCAAATTTTACCTCTTTCCTAACTTTTGATTTACTATATAGGCTA
TCTCAAATTCATGCCTAATGCTTTTCGTGAAATGCTGTATTATTACNNNNNNNNNNNNNNNNAACTTAGCTACATCCTCAATAGTGAACATTCCATATGTTGTGGATCCAATCATGAACC
GACAGCTCGAGCAACCCATGCCCAGTGCCCCTAATGCATGCTCCATGACTGATGTGCATATTTTTAAGCTTATAAAAATTTTGGAATAAATTAGGTCCGACGGATGGAAATTAAACATGT
CTAATCCATCCGTATGATTAAAAATTTCATCTTAATCACGGAACCTAACCCTCCTTTTTGAAATTTCCAATCCTTCGATTATTTTCCACATCATTTAGCTAGTTTTGTCCTCCTATAGGC
GGTGGAAACTTTGGTTGCACACAATTTTTTTCCCTTGGGGACCCACGAGGAGGATTTCTGGTGAAAGTCAACGTGATTGATTTGATCTGGACACTCGTTTTTTAAAGGGAAAAAAAACTG
ATTCCTGATATGTCTCTTTGGGTGCACATAGATGACGACGATATGTCCTGTGTTAGAACGCGTATGGTGCAGTGCAAGGCATCATCTTTCTGCTTAAAGGCAGCAAAGGTTGACAAATGA
GAATCTTCCCTTGGGCCAGAGAGATCACGATTGTTTTTGTTTGTATGCAGAGAATTAGAAGAACTTGTGGAAAGCCATAAAGATTGACTCTTTCTTTTTCCTCCCCTTAACGAGTTGAAA
ATTGAGAAAAAAACACGTGGAAAAGGAAACTCTGTTCAGCCTAAAATGATTCCTTGTGATGATTGCGTGTTAGTTTATAGACTATGAAGCTTTTGTTTATATGTATGAGCTAGTTAAGCT
AGGAGATTGACTTCTTAGCGACATAAAGAAAGTATCTCTTGCATTTCCCAAGATCCTTAAGAAGAAACTCTGTTTTGTGGCATTGTAAATTGGCAGGAGAGCAAGAATGCATCGATCATT
GCTTGAATAAATTTCGATACAGAAAATCACAACTTAAAGCGTGACAAGATACAGATGTGATGCATAGAACAAATGTCGATTGTGATTTTCAGGTTCTGAACATGGAGAGGAAGAGAGATT
GGCTAATCAAATGATAGATTTTATTTTGCAATGTCATTCTAAGTGATAATGTCTGATATGATGCAAAATGCTGCTCAGATATGTAGAACTACGCATGTGATGGGGAATGACATTCCTAGG
ATCTTTTAGGTTGTCTGATTAGTGAAAAAGCAAGAATTCTGAGAAGAGAATGTTTTTTTTTTGAGGTCAGTGATCTTAGCGACGGAAGCAATGTCTCCACCATTTGCATAATTACCGGAG
TCATGCTTTTTACTGATACTTTGGATTAACGAGAAACTGAAACGTTGTCCCCTTAGCCTAGCAGCTAGTGAATCATCAGTCATTAGTGATGGGATGATACTTGAGTTTCAGGATTCATAG
CAAGAATTGCAACATCTGAATAATATCTTTCTGGTTTGTACATTGGTGCAGACGATTGCTGCTGCTATTGTAGTTGGTGTCATCCTCCATGTGGGTGACCATCTTGCGTGCGATTTTGTG
AGGCTTGAACATGCGTCTAAAGACGTCTATCATAGATACTTGGAGGATGATTTTGGTAATCCGAAGCCGACGTACTTTGATCTTGTCAAGGGGATTGAAGGTGTGACTGGGATCCTCATG
GTGATCTTGATGTTAATAGCCTTCACATTGGCTACCCGATGGTTCCGCCGAAGCCTCGTCAAGTTACCGAAACCATTCGACCGGCTCACTGGTTTCAATGCATTTTGGTACTCACACCAC
CTGTTCGTGCTCGTCTATATCCTGCTCATCATTCACGGAGTCTTCCTTTACCTCGTTCACCACTGGTACCGCAAGACG
GTACGAATCGTTTTCTTTCCCTGCATTCCATGAACTTTCTGA
GAATTAGGCATCTTCAATGTGCTGCGTTCTTTTTCCAACATTGAAATATTGAAAGACAGCTGGTGTATTCCTAACGTAGTCGCATCTAAGTCCGCAGGACTTGAGTTTTGAAATGTGGAG
TTTGTGTCCTTGCAGACGTGGATGTATCTTGCTGTTCCTGTATTGCTCTATGCCGGAGAAAGGACCCTGAGATTCTTCAGGTCTGGAATGTACACGGTCCGACTGCTGAAGGTAACAAAA
GCATTCCCGCGTCATCCANNNNNNNAATTTGATACTCATCTTCATTCGTTGGGCCTTCAATTAAAATTGTTGACATTTAGAGCGAATCGTCTTGATTGTTTAGGTTGCGATCTACCCAGG
AAATGTCTTGACGTTAAAGATGTCGAAGCCTCCCCAATTTAAGTACAAAAGCGGGCAGTACATGTTTGTCCAGTGTCCTGCGGTTTCTCCATTCGAGTG
GTAAGTCCCCAAGTAATGACG
ATAAGTGTCACTGAGGACAATGCATTTTGCTTATGGTAATGGCCTTCTTGAGCGGACTGCTCAACTGCATATGGTCTCCTCGCATACATACTGATCTCTTCTCCCGACACACATTGCCAG

GCACCCATTTTCGATAACCTCAGCTCCCGGTGACGACTTCCTCAGTGTTCACATCCGTCAACTTGGCGACTGGACGCAAGAGCTCAAAAGGGTGTTCGCCGAGGCTTGTGAGCCTCCTGT
TGCAGGAAAGAGTGGCCTCCTCAGGGCTGATGAAACAACCAAGAAAAG
GTGCGCACACTTCCTGTTCCATTCTTTCGTTGTCCACAAGCTATAATTTTCCGATAACTGAACATGAGCTTC
TGGAATTAATGATAATCAAGACCACATTCCTTTGTTGATTACAGTTTGCCGAAGCTCTGCATAGACGGCCCATATGGCGCTCCAGCACAAGACTACAAAAAATACGATGTGTTGCTGCTG
GTTGGTCTCGGAATTGGGGCAACGCCTTTCATTAGTATCCTCAAAGATTTAATCAACACCATTGTCAAAAGCGAGGAGCAAGCA
GTAAGTACTACATACTCTTTAACTTTTTAATTACCT
TTCGAACAACATGATCGTGGACTGATGATGCAAATGAGAATGAATTGGCATTGTACCTGTGAGAATTCAAGACCAATTTTCCTTTTGCCTCCTTTCTTTGTTTGCAGGACTCAGTCACAG
ATGTCAGTAGGAACTCGGATTTAAGCATCGGGAGCGTTGAGTCACCTGGCCCGAACCGGGTCTCCCCAAGGCGCAGGAAGACTCTGAAAACCACCAATGCGTACTTCTACTGGGTGACGA
GAGAACAAGGGTCGTTCGATTGGTTCAAGGGGGTCATGAATGAGGTCGCGGAGATTGACCAAAGG
GTAAGAAAGAGTGCTTTCTCTTGAGCCCAATTTTCAGCTCATTAATCGAATTGAT
TGAAGTTTTGTCTTTACTGATCACGTTCTGGTGTGGGACTTCTAGGGGGTGATTGAGATGCACAATTATTTGACCAGTGTGTACGAGGAAGGTGATGCAAGATCAGCTCTCATCACTATG
GTCCAAGCTCTTAATCATGCCAAGAATGGGATAGACATTGTGTCTGGGACAACG
GTAAGTATCCTTCTTCCTCTTCTTCTTTTGTCAATTTAATATTTGTTGTTTTCTTTTCCAATCCAC
AACCGTACGTCACATCCTGAATCGCAAAATGGAAACGTTTGCATTCAGGTAAGGACTCATTTTGCAAGACCCAACAGGAAAAAGGCTTTCAATAAACTATGCTCCAAGCACAGCGGTGCA
AGAATAG
GTAATTCTCAACCCAGTTGAATCACAGAAGCTACTTAATCAATCTTCAAATATTCAATTTTTATTCCTTCTTTTTTTGGGTTTCCTTGAATCAGGTGTTTTCTACTGTGGAGC
GCCTGTTCTGGCCAAGGAGCTGAGCAAGCTCTGCTACGAATTCAACCAGAAAGGCCCCACCAAATTCGACTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGCCTCGCCAAGCACGGGCGCCGGTGGGCGTCGGACACCGTCCCCGGCAAGTCACCGGCCAGCGACAGCACTTCGCCGGCGGGTACGGAGGCCAGCTACGGCGAGGAGCTCGTG
GAGGTGACCCTC
GCCGGCGGCTTCGACGTGGCCCTGGCGGCCCGGGCCCTGCGGAAGCAGCGCGCGCAGCTCGACCGGAACCGCTCGGGCGCCCAAAAGGCCTTGCGCGGGCTGCGGTTC
ATCAGCAACAGCAAGACCAACTGCAGCATCGATGCATGGAACGAAATTCAGGCTAGCTTCGATAAGCTTGCCAAAGATGGTTGTCTCTATCGTCAAGATTTCGCACAATGCATAG
GAATG
AAAGATTCGAAGGAGTTTGCTTTGGAACTGTTCGATGCATTGGGGAGGAGGAGGAGAATGAAGGTCGACAGGATCAGCAAAGACGAGCTCCACGAGTTCTGGTGTCAGATCACTGATCAG
AGCTTCGATTCACGTCTCCAGATCTTCTTCGACAT
GGTAGACAAGAACGAGGACGGAAGAATCACCGGAGAAGAAGTAAAAGAGATCATAATGCTGAGCGCCTCGGCGAATCGATTATCG
AGGTTGAAGGAGCAGGCGGAGGAGTACGCAGCTCTGATCATGGAAGAACTGGATCCGGAGCAGCTCGGCTACATCGAG
CTATGGCAACTGGAGACGCTGCTGCTACAGAAGGATACGTAC
CTAAACTACAGCCAGGCGCTGAGCTACACGAGCCAAGCGCTGAGCCAAAACCTGCAGGGCCTGAGGAGGAGGAGCCGCATCAGGAGACTGAGCACCAAGTGCCTGTACTATCTGGAAGAG
AACTGGAGGAGGATTTGGGTGGTGACCTTGTGGGTCATGATCATGATCGGCCTCTTCACCTGGAAGTTCGTGCAGTACAAGCAGAAGGCCGCCTTCCAGGTCATGGGCTATTGCCTCCTC
ACGGCGAAGGGGGCCGCCGAGACGCTCAAGTTCAACATGGCCCTCATCCTGCTGCCGGTGTGCCGGAACACCATCACTTGGCTCCGCAACACGAGGGTCGGCCTCTTCATACCCTTCGAC
GACAACATCAACTTTCACAAG
ACGATTGCTGCTGCTATTGTAGTTGGTGTCATCCTCCATGTGGGTGACCATCTTGCGTGCGATTTTGTGAGGCTTGAACATGCGTCTAAAGACGTCTAT
CATAGATACTTGGAGGATGATTTTGGTAATCCGAAGCCGACGTACTTTGATCTTGTCAAGGGGATTGAAGGTGTGACTGGGATCCTCATGGTGATCTTGATGTTAATAGCCTTCACATTG
GCTACCCGATGGTTCCGCCGAAGCCTCGTCAAGTTACCGAAACCATTCGACCGGCTCACTGGTTTCAATGCATTTTGGTACTCACACCACCTGTTCGTGCTCGTCTATATCCTGCTCATC
ATTCACGGAGTCTTCCTTTACCTCGTTCACCACTGGTACCGCAAGACG
GTTGCGATCTACCCAGGAAATGTCTTGACGTTAAAGATGTCGAAGCCTCCCCAATTTAAGTACAAAAGCGGG
CAGTACATGTTTGTCCAGTGTCCTGCGGTTTCTCCATTCGAGTG
GCACCCATTTTCGATAACCTCAGCTCCCGGTGACGACTTCCTCAGTGTTCACATCCGTCAACTTGGCGACTGGACG
CAAGAGCTCAAAAGGGTGTTCGCCGAGGCTTGTGAGCCTCCTGTTGCAGGAAAGAGTGGCCTCCTCAGGGCTGATGAAACAACCAAGAAAAG
TTTGCCGAAGCTCTGCATAGACGGCCCA
TATGGCGCTCCAGCACAAGACTACAAAAAATACGATGTGTTGCTGCTGGTTGGTCTCGGAATTGGGGCAACGCCTTTCATTAGTATCCTCAAAGATTTAATCAACACCATTGTCAAAAGC
GAGGAGCAAGCA
GACTCAGTCACAGATGTCAGTAGGAACTCGGATTTAAGCATCGGGAGCGTTGAGTCACCTGGCCCGAACCGGGTCTCCCCAAGGCGCAGGAAGACTCTGAAAACCACC
AATGCGTACTTCTACTGGGTGACGAGAGAACAAGGGTCGTTCGATTGGTTCAAGGGGGTCATGAATGAGGTCGCGGAGATTGACCAAAGG
GGGGTGATTGAGATGCACAATTATTTGACC
AGTGTGTACGAGGAAGGTGATGCAAGATCAGCTCTCATCACTATGGTCCAAGCTCTTAATCATGCCAAGAATGGGATAGACATTGTGTCTGGGACAACG
GTAAGGACTCATTTTGCAAGA
CCCAACAGGAAAAAGGCTTTCAATAAACTATGCTCCAAGCACAGCGGTGCAAGAATAG
GTGTTTTCTACTGTGGAGCGCCTGTTCTGGCCAAGGAGCTGAGCAAGCTCTGCTACGAATTC
AACCAGAAAGGCCCCACCAAATTCGACTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA