Entry information : EglRboh03
Entry ID 11034
Creation 2012-05-18 (Qiang Li)
Last sequence changes 2012-05-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-16 (Christophe Dunand)
Peroxidase information: EglRboh03
Name EglRboh03
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglRboh03
start..stop
S start..stop
EgrRboh03 1651 0 29..814 13..798
EguRboh03 1595 0 29..814 13..798
EcamRboh03 1170 0 1..603 1..604
EcamRboh03 216 2e-60 710..814 574..678
EgrRboh06 1151 0 25..814 47..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..292 292 N° 2 406..568 163 N° 3 670..718 49 N° 4 800..913 114
N° 5 995..1801 807 N° 6 1928..2023 96 N° 7 2126..2241 116 N° 8 2333..2435 103
N° 9 2574..2665 92 N° 10 2749..2908 160 N° 11 2994..3128 135 N° 12 3229..3357 129
N° 13 3453..3531 79 N° 14 3685..3794 110  
join(1..292,406..568,670..718,800..913,995..1801,1928..2023,2126..2241,2333..243 5,2574..2665,2749..2908,2994..3128,3229..3357,3453..3531,3685..3794)


exon

Literature and cross-references EglRboh03
Protein sequence: EglRboh03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   814
PWM (Da):   %s   93291.47 Transmb domain:   %s   i261-280o347-369i397-419o445-467i633-650o
PI (pH):   %s   9.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDNAVETSESSAPPHPNDIPLPSRRNSSTTRKRNVSYGGIPRMERTASSASRGLMSLRFLDRTITGKEGDAWRSIEKRFHQHATNGQLSRDKFGVCIGMGDSKEFAGELFDALSRRRKVNAENGISIDQLRQFWEDMTTRELESRLQIFFDMCDKNGDGRLTEDEVKVIVLSAASNRLSNLQQQAASHASLIMERLDPDHQGYIEMWQLKTLLREMVNPDQRSKSSVNSQNLTRTMLPKGYRNPMSRLVHKNIERIHDNWRRIWVVGLWLVANMILFLWKFNKTRHGPAFDITGYCLCYAKGSAETLNLNMALVLLPVCRRTLTKLRSSFLGTFIPFDDNINFHKIIALAIAIGSVVHIAMHFMCNFPRITSCPKSQFKQVFGPYFHNRQPHYIDLVNNLSSTTGVLMFMMMAFSFTLATHWFRRNIIKLPWGLHHLAGFNAFWYAHHLLAVAYVFFILHGYFLVISRPWYTKTAWMYVMVPILLYTSERAFTSASELQHRVDIVKAIVYSGNVLALYMSKPPGFNYNSGMYLFVKCPDISKFEWHPFSITSAPGDAFLSVHMRALGDWTTELRNRFAVCEPPSKKPGKGGLTKMATRTSHNLEELQEKFPKIFIKGPYGAPAQDYEKYDILLLIGLGIGATPFISIIKDILNHVKLNKLQDSDQDQSSGARKGPKRAYFYWVTREQNSFEWFKGVMDDIAERDDHNVIEMHNYLTSLYEEGDARSALIAMVQKLQHAKNGVDIFSESQIKTHFARPNWRKVFSEIAMRHKSSRIGVFYCGSSVLTKTLRKLCQELSLESSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from NGS. First exon is probably missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACAATGCGGTGGAAACCAGTGAGAGCTCCGCCCCGCCGCATCCTAATGACATACCATTGCCATCGAGGCGGAACTCAAGCACGACGCGGAAGAGGAATGTATCGTACGGCGGCATC
CCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGCTTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGGAGATGCCTGGAGATCAATCGAGAAGCGTTTCCAT
CAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCTGCATTG
GTTGATCCTTAGAAAGTCTTGCTGCTATCTGAATCATGATTTTCCAGATAATAATAATAATAATAATT
GCACAATTTGATTGAGAAGTGACATTGTTTTATTCTGCGTGGAAGGAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGACGGAGGAAAGTGAATGCCGAGA
ATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGACATGACGACTCGAGAACTCGAATCCCGACTGCAGATATTCTTTGATAT
GTAAAGCAACTCTCGTCCATCTCCTATTATCG
TTCGCAACCTAAAGCGTACATTGCGTTGCTGGTAATACATGTGATGAAGTTTCGCGACGAATGCTGCAGGTGTGACAAGAATGGTGATGGGAGGCTAACTGAGGATGAGGTAAAAGAGGT
GAGGCAAAAGGAGACTTACTAATCACTCGTTTAGCGTGTCCTTTGGGCTCTTTTATGATGGACTGGAAATTTTTCAAAGGTGATAGTGTTGAGCGCCGCCTCGAATAGGCTGTCAAATCT
CCAGCAGCAAGCGGCATCTCACGCATCTCTGATCATGGAAAGACTTGATCCCGACCATCAAGGATACATCGAG
GTACCGAGTCAGATAGTCCATCATGTCCTGTTCGAGTTCGTGTTCCT
CCCATGTTGTTGTTCATCGCTTCTTTGTTTTCAGATGTGGCAATTAAAGACTCTCCTGAGAGAAATGGTGAACCCTGATCAAAGGAGCAAGTCGTCAGTGAATTCTCAAAACCTGACCAG
AACCATGCTTCCCAAAGGATACAGAAACCCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGGATCCATGACAATTGGAGGCGAATATGGGTCGTCGGGCTGTGGCTGGTCGCAAACAT
GATCCTCTTCCTTTGGAAGTTTAACAAAACGAGGCACGGCCCCGCCTTTGACATCACGGGCTATTGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACTCAATCTCAACATGGCTCTCGT
CCTCCTCCCCGTATGCAGAAGAACTCTCACGAAGCTACGCTCGTCCTTCCTTGGTACCTTCATACCATTCGACGACAACATAAACTTCCACAAGATAATCGCGCTGGCCATAGCTATAGG
ATCTGTCGTTCACATTGCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCCTGCCCAAAATCACAATTCAAGCAAGTGTTTGGCCCGTACTTCCATAATAGGCAACCTCATTACAT
CGACTTGGTCAATAACTTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCTTTCACACTGGCGACTCATTGGTTCAGGAGAAACATCATCAAGCTACCGTGGGGGCT
CCATCATTTAGCAGGATTTAATGCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTCTTCTTCATACTTCACGGCTACTTCCTCGTGATCAGTCGACCTTGGTACACGAAAAC
G
GTAAGTACACAATGGTCTAATTCCTTATTCTGTTCACCATTAATTCATAAGGCCTGAATTCTCCGGTCGTACCATCATTCCTCTGAAAACACGGCAAGAATCATTATACGGTTGGACTT
TATGCAGGCATGGATGTATGTGATGGTCCCAATCCTACTCTACACAAGCGAGAGAGCATTCACATCTGCTTCTGAACTCCAACATCGAGTTGATATCGTTAAGGTATCACTCACTTTACC
GAACTGCCGTGTTCCACATTCCTTTTTGGTTTACACGAATCTTAGTGCTACGATAAATTCATGCTCGGCTCAAAAAACTTTTCAGGCCATTGTTTATTCTGGAAACGTCCTTGCATTGTA
CATGAGCAAGCCTCCAGGTTTCAACTACAACAGCGGAATGTACCTTTTCGTCAAATGCCCTGATATATCAAAGTTCGAATG
GTGTATAGAACATAATCGCTGAAACCTATTTACTCGTCA
TACCCCTATGGCTTTTATTGCTGAAACTCATCGGTGTTTTTGCTCGGGACAGGCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTCTTGAGTGTTCACATGCGAGCCTTGGGCG
ATTGGACTACAGAGCTCAGGAATAGATTCGCCGAG
GTATATTCTATTGATTTTCTCATTCGTTTTTAGATTGCACAACCCATGGACTCTAGTCGAAAGATATAAAAAAATCACCACATTT
TCCATGTTGAGTATCGAACTCAATGTTCATCTTCTTCAATGAGAAATTGTTAGGTTTGTGAGCCACCAAGTAAAAAACCAGGGAAGGGAGGTCTAACGAAGATGGCCACGAGAACATCCC
ACAACTTGGAAGAGTTACAAGAGAA
GTGAGTGAAAATTATGGCTAAATTCTGTCCCACCCCTTCCATGCAAATGCTTTCGCTCTAACAGATATTCATTGTTGTCCAAGGTTTCCAAAGAT
TTTCATCAAGGGGCCATACGGTGCTCCGGCTCAGGACTACGAGAAGTATGACATCCTCCTACTCATCGGTCTTGGCATCGGAGCGACTCCTTTCATCAGCATCATAAAAGATATCCTGAA
TCACGTCAAGTTGAATAAGCTCCAAGCA
GTAAGTAGAAAAGGGAAAAACACTCGCACAAGCAATTTCAAATTCAGTTAGCACGACCATTTGCCAAAACTATTGATGCATGCAGGATTCGG
ATCAAGATCAATCATCAGGGGCAAGAAAAGGTCCTAAAAGAGCATACTTTTACTGGGTTACGAGGGAACAAAACTCTTTCGAGTGGTTCAAGGGCGTCATGGATGATATTGCAGAAAGAG
ACGATCAT
GTCGGTTCGCCATTTCCAAAACTACCAAGTGTGATGAATCCTCCAATTAATTATAGTTTTTCAACTAAAATGTCGCTTTGGGTACTGGTGATTGTTGTAGAATGTAATAGAG
ATGCACAACTACCTGACCTCTCTATATGAGGAAGGAGATGCGAGATCAGCACTCATTGCCATGGTCCAAAAGTTGCAGCACGCGAAGAATGGTGTCGACATCTTCTCGGAAAGTCAG
GTA
ACTCTTGATCAGTCACACAAAAGAAAAACAAAGAAACATTCACAGCACAATGCACCTATTTAGGCTGTCCTTTAACGTTGCTTGTTCGACAGATAAAAACTCACTTTGCGAGGCCTAATT
GGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCTCGTATAG
GTACGACATCACGTCCGATGAACGTGTCAACATAATGGCACTTGATTTGGTTGTTCTAGCCAGTTTGGA
ACATGAACCTGTGATTTTCTAACTGTTGGAACTTGAACATTCTACCAATTCGGGTCTGATATGTCGGTAATAATTTTCCTGCAGGTGTTTTCTATTGTGGGAGTTCGGTGCTCACCAAAA
CACTGAGGAAGCTATGTCAAGAACTCAGCCTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACAATGCGGTGGAAACCAGTGAGAGCTCCGCCCCGCCGCATCCTAATGACATACCATTGCCATCGAGGCGGAACTCAAGCACGACGCGGAAGAGGAATGTATCGTACGGCGGCATC
CCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGCTTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGGAGATGCCTGGAGATCAATCGAGAAGCGTTTCCAT
CAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCTGCATTG
GAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGACGGAGGAAAGTGAAT
GCCGAGAATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGACATGACGACTCGAGAACTCGAATCCCGACTGCAGATATTCTTTGATAT
GTGTGACAAGAATGGTGATGGGAGG
CTAACTGAGGATGAGGTAAAAGAG
GTGATAGTGTTGAGCGCCGCCTCGAATAGGCTGTCAAATCTCCAGCAGCAAGCGGCATCTCACGCATCTCTGATCATGGAAAGACTTGATCCCGAC
CATCAAGGATACATCGAG
ATGTGGCAATTAAAGACTCTCCTGAGAGAAATGGTGAACCCTGATCAAAGGAGCAAGTCGTCAGTGAATTCTCAAAACCTGACCAGAACCATGCTTCCCAAA
GGATACAGAAACCCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGGATCCATGACAATTGGAGGCGAATATGGGTCGTCGGGCTGTGGCTGGTCGCAAACATGATCCTCTTCCTTTGG
AAGTTTAACAAAACGAGGCACGGCCCCGCCTTTGACATCACGGGCTATTGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACTCAATCTCAACATGGCTCTCGTCCTCCTCCCCGTATGC
AGAAGAACTCTCACGAAGCTACGCTCGTCCTTCCTTGGTACCTTCATACCATTCGACGACAACATAAACTTCCACAAGATAATCGCGCTGGCCATAGCTATAGGATCTGTCGTTCACATT
GCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCCTGCCCAAAATCACAATTCAAGCAAGTGTTTGGCCCGTACTTCCATAATAGGCAACCTCATTACATCGACTTGGTCAATAAC
TTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCTTTCACACTGGCGACTCATTGGTTCAGGAGAAACATCATCAAGCTACCGTGGGGGCTCCATCATTTAGCAGGA
TTTAATGCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTCTTCTTCATACTTCACGGCTACTTCCTCGTGATCAGTCGACCTTGGTACACGAAAACG
GCATGGATGTATGTG
ATGGTCCCAATCCTACTCTACACAAGCGAGAGAGCATTCACATCTGCTTCTGAACTCCAACATCGAGTTGATATCGTTAAG
GCCATTGTTTATTCTGGAAACGTCCTTGCATTGTACATG
AGCAAGCCTCCAGGTTTCAACTACAACAGCGGAATGTACCTTTTCGTCAAATGCCCTGATATATCAAAGTTCGAATG
GCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTCTTG
AGTGTTCACATGCGAGCCTTGGGCGATTGGACTACAGAGCTCAGGAATAGATTCGCCGAG
GTTTGTGAGCCACCAAGTAAAAAACCAGGGAAGGGAGGTCTAACGAAGATGGCCACGAGA
ACATCCCACAACTTGGAAGAGTTACAAGAGAA
GTTTCCAAAGATTTTCATCAAGGGGCCATACGGTGCTCCGGCTCAGGACTACGAGAAGTATGACATCCTCCTACTCATCGGTCTTGGC
ATCGGAGCGACTCCTTTCATCAGCATCATAAAAGATATCCTGAATCACGTCAAGTTGAATAAGCTCCAAGCA
GATTCGGATCAAGATCAATCATCAGGGGCAAGAAAAGGTCCTAAAAGA
GCATACTTTTACTGGGTTACGAGGGAACAAAACTCTTTCGAGTGGTTCAAGGGCGTCATGGATGATATTGCAGAAAGAGACGATCAT
AATGTAATAGAGATGCACAACTACCTGACCTCT
CTATATGAGGAAGGAGATGCGAGATCAGCACTCATTGCCATGGTCCAAAAGTTGCAGCACGCGAAGAATGGTGTCGACATCTTCTCGGAAAGTCAG
ATAAAAACTCACTTTGCGAGGCCT
AATTGGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCTCGTATAG
GTGTTTTCTATTGTGGGAGTTCGGTGCTCACCAAAACACTGAGGAAGCTATGTCAAGAACTCAGC
CTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA