Entry information : EglRboh06
Entry ID 11035
Creation 2012-05-18 (Qiang Li)
Last sequence changes 2012-05-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-16 (Christophe Dunand)
Peroxidase information: EglRboh06
Name EglRboh06
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglRboh06
start..stop
S start..stop
EgrRboh06 1788 0 1..857 1..857
EguRboh06 1773 0 1..857 1..857
EcamRboh06 1758 0 1..857 1..857
VvRboh08 1253 0 3..857 11..843
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..370 370 N° 2 474..636 163 N° 3 707..755 49 N° 4 849..962 114
N° 5 1061..1867 807 N° 6 2143..2238 96 N° 7 2329..2444 116 N° 8 2545..2647 103
N° 9 2770..2861 92 N° 10 2941..3151 211 N° 11 3183..3317 135 N° 12 3450..3578 129
N° 13 3653..3731 79 N° 14 3839..3948 110  
join(1..370,474..636,707..755,849..962,1061..1867,2143..2238,2329..2444,2545..26 47,2770..2861,2941..3151,3183..3317,3450..3578,3653..3731,3839..3948)


exon

Literature and cross-references EglRboh06
Protein sequence: EglRboh06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   857
PWM (Da):   %s   98215.55 Transmb domain:   %s   o290-308i423-445o471-493i659-676o
PI (pH):   %s   9.78
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGDSSKWILESIEVDDMADVPLDSSNKSGVHSGGPTSKVNDEAMLARSSSSTRKRVGFQGTRPPALSRMGRTESGARRGLKSLRFLDRTITGKEVDAWKSMEKRFNQFAVDGRISKDKFGTCIGMGESKEFAGELFETLARRRKIHSENGITQEEMRAFWDDMTNQDIDSRLQIFFDMCDKNGDGKLSEEEVKVIILSASANKLSNLKPQAASYAVLIMEELDPDHLGYIEMWQLETLLREMVSSEEANKLAKKTHTLARTMIPRQYRTPISKFLLKTFEFLQENWKRVWVMSLWLTLNLILFVWKFRQYKERDIFQVMGYCVCFAKGAAETLKFNMALILIPVCRRTLTKLRSTALSRIFPFDDNINFHKSIALAIVIGTSIHIIMHLSCDFPRLISCPKPKFLRYAGPNFNYKQPSYLDLVESVPGVTGIIITILMAFSFTLATHSFRRNVIKLPWPFHHLAGFNAFWYAHHLLFLVYALLIVHGYFLFLSRHWYSKSTWMYLSVPLLLYVSERIFTAIDERNHRVNVIKAIIYTGNVLALYISKPPGFKYKSGMYMFVKCPDISNFEWHPFSITSAPGDDYLSVHIRTLGDWTTELKNRFAVCEPPNEPAGRGSLVRLQTKAISDYDHTQVRFPRILIKGPYGAPAQNYKKYDILFLIGLGIGATPFISILKDLLNQIKPNEQNNVSQKFITSNKFSRCRRDPGQSIPGANKKAPERAYFYWVTREQGSFEWFKGVMDDIAEYDHNHIIEMHNYLTSVYEEGDARSALIAMVQKLQHAKNGVDVVSESRIRTHFARPNWRKVFSQLASAHPSSRIGVFYCGSPTLTKPLKKLCQEFSLNSSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from NGS.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGACTCCTCTAAATGGATTCTGGAAAGCATCGAGGTCGACGACATGGCCGATGTGCCCTTGGACAGCTCCAACAAAAGCGGCGTTCATAGCGGCGGCCCGACTTCCAAGGTGAAC
GATGAGGCAATGCTCGCCCGGAGCTCGAGCAGCACGAGGAAGCGAGTTGGGTTTCAGGGCACTAGGCCACCGGCGTTGTCTAGGATGGGAAGGACCGAATCCGGTGCCAGGAGAGGGCTC
AAGAGCTTGAGGTTCTTGGACAGGACCATCACAGGGAAGGAGGTGGACGCTTGGAAGTCCATGGAGAAACGTTTCAACCAATTCGCAGTCGATGGGAGGATCTCGAAGGACAAGTTCGGG
ACCTGCATTG
GTAATTCGACGCTGACTTGGAAACCCCAAGACGGGGTCCTGCTTGAAATCTAACTTTTCCTGGGGAAAAAAGAGCTCAGGGGTTGTGAAATGCTGTGTTGCAGGAATGGG
AGAATCCAAGGAATTTGCGGGGGAGCTGTTTGAGACATTGGCGAGGCGTAGGAAGATACACTCGGAGAACGGGATTACTCAGGAGGAAATGAGGGCATTTTGGGACGATATGACTAACCA
GGACATTGACTCACGCCTTCAAATCTTCTTTGACAT
GTAAAGAATTGTGCTTTCTGTGTCTCTTGGTTGTGTTGTTCACAGGAAACTAACTTCGCTAGTGTTTCAGGTGTGACAAAAATG
GCGATGGTAAGCTCTCCGAGGAGGAGGTGAAGGAG
GTGAGAGATAGCAACTTCCCAAAATCTCCTCTTCTTGTGTTTTTGGACGCTAATGGATAAAATTCTTTTACCTTTTAATTCTGGC
AAGTGAAGGTAATCATATTGAGCGCTTCAGCAAACAAGCTGTCCAATCTCAAGCCGCAAGCCGCATCCTATGCTGTGTTGATCATGGAAGAGCTCGATCCTGACCATCTCGGGTATATCG
AA
GTGAGTAGAAGTCTAGAGCCATTCCTTGAGAAGAGCATGTTTGTGTGTTCATCTATCGAGTCCTCTCTCTCTCTTCCTAATTTTGCAAGCTTAAGCAGATGTGGCAACTCGAGACTCT
ACTGAGGGAGATGGTGAGCTCCGAAGAAGCCAACAAGCTGGCCAAAAAAACCCACACTCTTGCAAGGACCATGATTCCGAGACAATATAGGACTCCGATCAGCAAATTTTTATTGAAAAC
CTTCGAATTTCTCCAGGAGAATTGGAAGAGAGTGTGGGTCATGTCACTTTGGTTGACTCTAAATTTGATCCTTTTTGTCTGGAAGTTCCGTCAATACAAGGAGAGAGACATATTTCAAGT
CATGGGTTACTGTGTTTGTTTTGCGAAGGGCGCTGCTGAGACGCTCAAATTCAACATGGCCCTTATTCTCATCCCTGTGTGTAGGAGGACGCTTACTAAACTTAGATCAACTGCCCTAAG
TAGGATATTTCCTTTCGACGACAATATTAATTTCCACAAGTCGATAGCACTGGCAATAGTAATCGGGACTTCAATACATATTATTATGCACCTTTCGTGTGATTTCCCAAGACTAATTTC
ATGTCCTAAGCCAAAGTTTTTGAGGTACGCGGGGCCTAACTTCAATTACAAGCAGCCAAGTTACTTGGATCTAGTTGAGAGCGTTCCTGGTGTTACCGGGATTATAATTACCATCTTGAT
GGCTTTCTCTTTCACACTGGCCACGCATTCATTTAGAAGGAATGTCATCAAGTTACCTTGGCCATTCCACCATCTAGCCGGGTTCAATGCCTTCTGGTACGCTCACCATTTGCTGTTCCT
GGTCTATGCTCTCTTGATAGTGCACGGCTACTTCCTGTTTCTGAGTAGGCACTGGTACTCAAAAAGT
GTAAGTATGATTTATGCACTTGAACTAAATCATTTTATTTGTTCATAGATTTG
TCAGATGATTTTACTGCGACGACAGAACTGTTTCTGCTTAACAATGTGTTTGTATTCAATGCTATGCTTAACATGTCATCTTTGGTTCATTGCATATTCGAATTTCATTGAACGTGTTCT
TGAGCTTAAAATGCCTTATAACTTTGTCAAGTGATATTGCTGTCTTAGTTTCATGCTGATGAAAGAAAGCTATTATGAACTGTTAAATTTCTTCCTGTGCAGACATGGATGTATCTCTCT
GTTCCTTTATTACTTTATGTCAGCGAGAGAATTTTCACAGCTATTGACGAGCGCAACCATCGTGTCAATGTTATCAAG
GTCAGCAATCATAGAGCTCTCCTGCCTTCAATTCTCAAGTCC
CAGGAACATGTATAAGTGCTTATGAACTGAATACATGAGTTATTGCAGGCAATCATATACACAGGAAATGTTTTGGCGTTGTACATAAGCAAACCCCCAGGATTCAAGTATAAAAGCGGA
ATGTATATGTTTGTCAAGTGTCCAGATATTTCCAACTTCGAGTG
GTAATGCATTGCTTTACTCAACAACAGGCTAAACCAAGTCTGTTAGCTGCTAGCTGCACATTTTTATGAATTGAGC
TGATTGATTTGTCACTTGTCATAGGCATCCTTTTTCTATCACTTCCGCACCAGGAGATGACTACTTGAGTGTCCACATACGAACCTTGGGAGACTGGACCACGGAGCTTAAGAACAGATT
TGCACAG
GTTAACAGATTATGGTGCTATGGCTAGAAGTTTATCTACTATAACGCACTACTGCTTGCTTCTTGATCTTAAATGTCTCACTTTCTGTTTCCACTTTTAAGTGCTAAGTCGAA
GAATTGCAGGTTTGTGAGCCACCGAACGAGCCAGCGGGAAGGGGAAGTCTAGTGAGGCTTCAAACCAAGGCAATCTCAGATTATGATCACACACAAGTCAGGTGGAGCAAAGTTTTGGTG
ATCTCGTTTTGTGGCTTCAATGATGTTGTTAAATCTCATAATTTCTCCTCAATTTTATAGATTCCCGAGAATCCTCATTAAGGGACCGTATGGAGCCCCAGCTCAGAACTACAAAAAGTA
CGACATCCTTTTCCTTATCGGTCTAGGGATCGGGGCAACACCATTTATCAGCATTTTGAAGGACCTCCTCAACCAGATCAAGCCGAACGAACAAAACAATGTGAGCCAAAAGTTTATAAC
TTCAAACAAGTTTAGCAGATGTAGGAGACAA
GTAGTAAACAGGATGATTTGACCACTTGCAGGATCCTGGACAAAGCATACCAGGTGCAAATAAGAAGGCACCGGAAAGAGCATACTTTT
ATTGGGTAACAAGGGAACAGGGTTCGTTTGAATGGTTCAAAGGTGTGATGGATGATATCGCAGAATACGACCATAAT
GTAAGTTCCAAAACAATGGAAAACATGCTTCATGACCACCTCG
CCTTCTTACGTTTACACTCATTCTTGTAGTAGCACATCCTCTTCTGTTTATATCATTCTCACTGTTTATTGGTCTAATGAGCTGAGCAGCATATAATAGAGATGCACAACTACTTGACTA
GTGTATATGAAGAAGGAGATGCACGGTCAGCACTCATCGCAATGGTGCAGAAGCTGCAGCATGCAAAGAATGGAGTGGATGTTGTCTCAGAAAGCCGG
GTATATGCCTCTAGTTATTATT
CCTCTGATCATTTAATTCATGTCTGGCTCATTTCTGACATACGTGCGCACAGATAAGAACGCATTTTGCGAGGCCTAACTGGAGAAAGGTGTTCTCCCAACTGGCAAGTGCTCATCCTTC
TTCTCGAATAG
GTACTGGTTTTGATTTGCGGCCATGGAGAAATGTCAAAATGCACTTAACTGATGAGATTGTTCTCATTCTGCCTCTTGCCTCTAATGTGGATGTTGGGCCCTTGCAGGT
GTTTTCTACTGTGGAAGTCCAACGCTTACTAAGCCGTTAAAGAAGCTTTGTCAAGAATTCAGCCTAAACTCATCGACCCGTTTCCAATTTCACAAGGAAAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGACTCCTCTAAATGGATTCTGGAAAGCATCGAGGTCGACGACATGGCCGATGTGCCCTTGGACAGCTCCAACAAAAGCGGCGTTCATAGCGGCGGCCCGACTTCCAAGGTGAAC
GATGAGGCAATGCTCGCCCGGAGCTCGAGCAGCACGAGGAAGCGAGTTGGGTTTCAGGGCACTAGGCCACCGGCGTTGTCTAGGATGGGAAGGACCGAATCCGGTGCCAGGAGAGGGCTC
AAGAGCTTGAGGTTCTTGGACAGGACCATCACAGGGAAGGAGGTGGACGCTTGGAAGTCCATGGAGAAACGTTTCAACCAATTCGCAGTCGATGGGAGGATCTCGAAGGACAAGTTCGGG
ACCTGCATTG
GAATGGGAGAATCCAAGGAATTTGCGGGGGAGCTGTTTGAGACATTGGCGAGGCGTAGGAAGATACACTCGGAGAACGGGATTACTCAGGAGGAAATGAGGGCATTTTGG
GACGATATGACTAACCAGGACATTGACTCACGCCTTCAAATCTTCTTTGACAT
GTGTGACAAAAATGGCGATGGTAAGCTCTCCGAGGAGGAGGTGAAGGAGGTAATCATATTGAGCGCT
TCAGCAAACAAGCTGTCCAATCTCAAGCCGCAAGCCGCATCCTATGCTGTGTTGATCATGGAAGAGCTCGATCCTGACCATCTCGGGTATATCGAA
ATGTGGCAACTCGAGACTCTACTG
AGGGAGATGGTGAGCTCCGAAGAAGCCAACAAGCTGGCCAAAAAAACCCACACTCTTGCAAGGACCATGATTCCGAGACAATATAGGACTCCGATCAGCAAATTTTTATTGAAAACCTTC
GAATTTCTCCAGGAGAATTGGAAGAGAGTGTGGGTCATGTCACTTTGGTTGACTCTAAATTTGATCCTTTTTGTCTGGAAGTTCCGTCAATACAAGGAGAGAGACATATTTCAAGTCATG
GGTTACTGTGTTTGTTTTGCGAAGGGCGCTGCTGAGACGCTCAAATTCAACATGGCCCTTATTCTCATCCCTGTGTGTAGGAGGACGCTTACTAAACTTAGATCAACTGCCCTAAGTAGG
ATATTTCCTTTCGACGACAATATTAATTTCCACAAGTCGATAGCACTGGCAATAGTAATCGGGACTTCAATACATATTATTATGCACCTTTCGTGTGATTTCCCAAGACTAATTTCATGT
CCTAAGCCAAAGTTTTTGAGGTACGCGGGGCCTAACTTCAATTACAAGCAGCCAAGTTACTTGGATCTAGTTGAGAGCGTTCCTGGTGTTACCGGGATTATAATTACCATCTTGATGGCT
TTCTCTTTCACACTGGCCACGCATTCATTTAGAAGGAATGTCATCAAGTTACCTTGGCCATTCCACCATCTAGCCGGGTTCAATGCCTTCTGGTACGCTCACCATTTGCTGTTCCTGGTC
TATGCTCTCTTGATAGTGCACGGCTACTTCCTGTTTCTGAGTAGGCACTGGTACTCAAAAAGT
ACATGGATGTATCTCTCTGTTCCTTTATTACTTTATGTCAGCGAGAGAATTTTCACA
GCTATTGACGAGCGCAACCATCGTGTCAATGTTATCAAG
GCAATCATATACACAGGAAATGTTTTGGCGTTGTACATAAGCAAACCCCCAGGATTCAAGTATAAAAGCGGAATGTATATG
TTTGTCAAGTGTCCAGATATTTCCAACTTCGAGTG
GCATCCTTTTTCTATCACTTCCGCACCAGGAGATGACTACTTGAGTGTCCACATACGAACCTTGGGAGACTGGACCACGGAGCTT
AAGAACAGATTTGCACAG
GTTTGTGAGCCACCGAACGAGCCAGCGGGAAGGGGAAGTCTAGTGAGGCTTCAAACCAAGGCAATCTCAGATTATGATCACACACAAGTCAGATTCCCGAGA
ATCCTCATTAAGGGACCGTATGGAGCCCCAGCTCAGAACTACAAAAAGTACGACATCCTTTTCCTTATCGGTCTAGGGATCGGGGCAACACCATTTATCAGCATTTTGAAGGACCTCCTC
AACCAGATCAAGCCGAACGAACAAAACAATGTGAGCCAAAAGTTTATAACTTCAAACAAGTTTAGCAGATGTAGGAGACAA
GATCCTGGACAAAGCATACCAGGTGCAAATAAGAAGGCA
CCGGAAAGAGCATACTTTTATTGGGTAACAAGGGAACAGGGTTCGTTTGAATGGTTCAAAGGTGTGATGGATGATATCGCAGAATACGACCATAAT
CATATAATAGAGATGCACAACTAC
TTGACTAGTGTATATGAAGAAGGAGATGCACGGTCAGCACTCATCGCAATGGTGCAGAAGCTGCAGCATGCAAAGAATGGAGTGGATGTTGTCTCAGAAAGCCGG
ATAAGAACGCATTTT
GCGAGGCCTAACTGGAGAAAGGTGTTCTCCCAACTGGCAAGTGCTCATCCTTCTTCTCGAATAG
GTGTTTTCTACTGTGGAAGTCCAACGCTTACTAAGCCGTTAAAGAAGCTTTGTCAA
GAATTCAGCCTAAACTCATCGACCCGTTTCCAATTTCACAAGGAAAACTTCTAG

Retrieve as FASTA