Entry information : Egl1CysPrx03-1
Entry ID 11044
Creation 2012-05-21 (Qiang Li)
Last sequence changes 2013-03-13 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-03-13 (Qiang Li)
Peroxidase information: Egl1CysPrx03-1
Name Egl1CysPrx03-1
Class 1-Cysteine peroxiredoxin    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Egl1CysPrx03-1
start..stop
S start..stop
Ecam1CysPrx03-1 414 2e-150 1..198 19..216
Egu1CysPrx03 414 3e-150 1..198 19..216
Egr1CysPrx03 414 3e-150 1..198 19..216
Ecam1CysPrx03-2 409 3e-148 1..198 19..216
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..64 64 N° 2 169..317 149 N° 3 685..831 147 N° 4 961..1194 234
join(1..64,169..317,685..831,961..1194)


exon

Literature and cross-references Egl1CysPrx03-1
Protein sequence: Egl1CysPrx03-1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   198
PWM (Da):   %s   21932.35  
PI (pH):   %s   8.78
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
HGKMKLHDYIGGAWTVLFSHPGDFTPVCTTELGKMAAYAPEFERRGVKLLGLSCDEVESHKAWIKDIEAFPGAKVTYPIIADPNREIIKQLNMVEPEEKDASGKQVPSRALHIVGPDKKIKLSFLYPASTGRNMDEVVRVLESLQRATKHKIATPCNWKPGEAVVISPSVSNEQAKEMFPQGYKTANLPSKKDYLRF

Retrieve as FASTA  
Remarks Partial sequence from NGS. 5' end is missing due to NNNN in DNA.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CACGGCAAGATGAAGCTCCACGACTACATCGGCGGCGCCTGGACCGTCCTCTTCTCTCACCCCGGTAACCGTCGNNNNNNNNNNNNNNTCCCCTTTTGCCCGACTCCGCATGTTTTGACG
GCCCCGAGAAAAGGGAAGTCTTGTTCACCCACGACATCGCTTGCGCAGGGGATTTCACGCCGGTGTGTACGACGGAGCTCGGGAAGATGGCGGCGTACGCGCCGGAGTTCGAGCGGCGAG
GGGTGAAGCTCCTGGGCTTGTCCTGCGACGAGGTCGAGTCGCACAAGGCGTGGATCAAGGACATAGAGGCCTTCACC
GTCAGCTACTCTTCTCCCTATTAAACCTTTTTTTTTTATCACT
TGGCACATATGTATATGTCTTGTAGGAACTTGCTTTTTGGGATTTTGATGTTGTGTTTTATCTGGCTATGGTGATAGTATCCTTCAGAAAGAAAAAGAAAGAGAACTTATAGGAATGTGT
AGTATTATGATTTAGTAGAGTGACCAAGGGAAGTCTCCTTAATCTTAGGCACAATTTGGGTAGAATGAGGTGGTTTAATTGCGGGTCACAGGGCTGACTGTTCTGTTTCACATTTGAGAT
TGGGACCTTTGGCTTTTGTGCAATTTTCATTATTCCAATTTCGAGCCAACATTCTCAATGTCGTGTTATTTGGTGGGGGTGTAGCCTGGTGCTAAGGTGACGTACCCGATAATCGCCGAC
CCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCGGAGGAGAAAGACGCCTCCGGGAAGCAAGTCCCTTCTAGAGCTCTGCACATCGTCGGTCCTGATAAGAAG
GTATACGTG
CTCCTCTTAACTTTTCTATTCCGTATTAATCAAACTTTTATCGGATGAAACAAATTGCATAAACCAATGTCATCTCATGCATGTCGTTTTCGTTTTCACGATATAACATAAATTGTATAG

ATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACATGGACGAGGTGGTGAGGGTGCTGGAATCGCTGCAGAGGGCGACGAAGCACAAGATCGCCACCCCGTGCAACTGGAAG
CCGGGGGAGGCAGTTGTCATCTCACCGTCCGTCTCCAACGAGCAGGCCAAGGAGATGTTCCCGCAGGGCTACAAGACCGCCAATCTCCCGTCCAAGAAGGATTACCTCCGCTTC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CACGGCAAGATGAAGCTCCACGACTACATCGGCGGCGCCTGGACCGTCCTCTTCTCTCACCCCGGGGATTTCACGCCGGTGTGTACGACGGAGCTCGGGAAGATGGCGGCGTACGCGCCG
GAGTTCGAGCGGCGAGGGGTGAAGCTCCTGGGCTTGTCCTGCGACGAGGTCGAGTCGCACAAGGCGTGGATCAAGGACATAGAGGCCTTCACC
CCTGGTGCTAAGGTGACGTACCCGATA
ATCGCCGACCCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCGGAGGAGAAAGACGCCTCCGGGAAGCAAGTCCCTTCTAGAGCTCTGCACATCGTCGGTCCTGATAAGAAG
ATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACATGGACGAGGTGGTGAGGGTGCTGGAATCGCTGCAGAGGGCGACGAAGCACAAGATCGCCACCCCGTGCAACTGGAAG
CCGGGGGAGGCAGTTGTCATCTCACCGTCCGTCTCCAACGAGCAGGCCAAGGAGATGTTCCCGCAGGGCTACAAGACCGCCAATCTCCCGTCCAAGAAGGATTACCTCCGCTTC

Retrieve as FASTA